Rmu_co8436523.1_g000001

Uncharacterized ACR, COG1399

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8436523.1
Physical Location & Seq
Reverse (-)
1 .. 1222
1222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8436523.1_g000001.1.cds

Sequence Viewer

Length: 324 bp
atggcagaagttgctaatttggtatcagcaagaaatattaagcttctttgtataaacccagcaaaccccaaatcctccaaagcggtttattctcagagtttcagaatcagagcttcttcaaaaagaaacgatttctctctgattaacaaaaagaacagcaggcgcagtgtgatcagaatatcaacagcagatgggagatggcatggaaattggggttgtgattaccttctgtcccttcaagacctgcgtttgggagatttggtcgaagaagatgatggaaataaaaaggatgcacaagttttagtcaacctctccgtccacaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.13

Weight (kDa)

9.79

Isoelectric Point (pI)

60.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 252
AciI CCGC 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 250
AgsI TTSAA 2 cut(s) 120, 239
AluBI AGCT 2 cut(s) 43, 113
AluI AGCT 2 cut(s) 43, 113
AspLEI GCGC 1 cut(s) 165
BccI CCATC 3 cut(s) 185, 192, 269
BclI TGATCA 1 cut(s) 171
BfuAI ACCTGC 1 cut(s) 252
BmsI GCATC 1 cut(s) 280
BsaXI ACNNNNNCTCC 2 cut(s) 246, 276
Bsc4I CCNNNNNNNGG 1 cut(s) 250
BseGI GGATG 1 cut(s) 295
BseLI CCNNNNNNNGG 1 cut(s) 250
BseMII CTCAG 1 cut(s) 107
BseYI CCCAGC 1 cut(s) 58
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 1 cut(s) 250
BsmFI GGGAC 1 cut(s) 217
Bsp143I GATC 1 cut(s) 171
BspACI CCGC 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 106
BspMI ACCTGC 1 cut(s) 252
BssMI GATC 1 cut(s) 171
BstAPI GCANNNNNTGC 1 cut(s) 11
BstC8I GCNNGC 1 cut(s) 161
BstDEI CTNAG 1 cut(s) 93
BstF5I GGATG 1 cut(s) 295
BstHHI GCGC 1 cut(s) 165
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstMWI GCNNNNNNNGC 1 cut(s) 11
BtsCI GGATG 1 cut(s) 295
BtsI GCAGTG 1 cut(s) 172
BtsIMutI CAGTG 1 cut(s) 172
BveI ACCTGC 1 cut(s) 252
Cac8I GCNNGC 1 cut(s) 161
CfoI GCGC 1 cut(s) 165
CviAII CATG 1 cut(s) 203
CviJI RGCY 2 cut(s) 43, 113
CviKI_1 RGCY 2 cut(s) 43, 113
DdeI CTNAG 1 cut(s) 93
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
FaeI CATG 1 cut(s) 206
FaiI YATR 2 cut(s) 53, 204
FaqI GGGAC 1 cut(s) 217
FatI CATG 1 cut(s) 202
FbaI TGATCA 1 cut(s) 171
FokI GGATG 1 cut(s) 302
GlaI GCGC 1 cut(s) 164
GsaI CCCAGC 1 cut(s) 62
HhaI GCGC 1 cut(s) 165
Hin1II CATG 1 cut(s) 206
Hin6I GCGC 1 cut(s) 163
HinP1I GCGC 1 cut(s) 163
HincII GTYRAC 1 cut(s) 307
HindII GTYRAC 1 cut(s) 307
HindIII AAGCTT 1 cut(s) 41
HinfI GANTC 1 cut(s) 105
Hpy166II GTNNAC 2 cut(s) 307, 319
Hpy188I TCNGA 5 cut(s) 96, 104, 110, 141, 176
Hpy188III TCNNGA 1 cut(s) 239
Hpy8I GTNNAC 2 cut(s) 307, 319
HpyAV CCTTC 2 cut(s) 236, 245
HpyCH4V TGCA 1 cut(s) 293
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 93
Hsp92II CATG 1 cut(s) 206
HspAI GCGC 1 cut(s) 163
Ksp22I TGATCA 1 cut(s) 171
Kzo9I GATC 1 cut(s) 171
LpnPI CCDG 3 cut(s) 72, 145, 257
LweI GCATC 1 cut(s) 280
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MboII GAAGA 3 cut(s) 108, 278, 281
MluCI AATT 2 cut(s) 16, 208
MnlI CCTC 2 cut(s) 85, 320
MseI TTAA 2 cut(s) 39, 144
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 1 cut(s) 171
NlaIII CATG 1 cut(s) 206
PfeI GAWTC 1 cut(s) 105
PspFI CCCAGC 1 cut(s) 58
SaqAI TTAA 2 cut(s) 39, 144
Sau3AI GATC 1 cut(s) 171
SetI ASST 5 cut(s) 45, 115, 228, 246, 312
SfaNI GCATC 1 cut(s) 280
SgeI CNNG 7 cut(s) 42, 71, 172, 215, 251, 256, 308
Sse9I AATT 2 cut(s) 16, 208
SsiI CCGC 1 cut(s) 83
SspI AATATT 1 cut(s) 37
TaqI TCGA 1 cut(s) 264
TasI AATT 2 cut(s) 16, 208
TfiI GAWTC 1 cut(s) 105
Tru1I TTAA 2 cut(s) 39, 144
Tru9I TTAA 2 cut(s) 39, 144
TscAI CASTG 1 cut(s) 172
TspGWI ACGGA 1 cut(s) 304
TspRI CASTG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.