Rh4AG096900

Uncharacterized ACR, COG1399

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
20558828 .. 20561646
2819 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG096900.1

Sequence Viewer

Length: 531 bp
ATGGTTTTCAGAGAAATGGCAGAAGTTGCTAATTTGGTATCAGCAAGAAATATCAAGCTTCTTTGTATAAACCCAGCAAACCCCAAATCCTCCAAAGCGGTTTATTCTCAGAGTTTCAGAATCAGAGCTTCTTCAAAAAGAAACGATTTCTCTCTGATTAACAAAAAGAACAGCAGGCGCAGTGTGATCAGAATATCAACAGCAGATGGGAGATGGCATGGAAATTGGGGTTGTGATTACCTTCTGTCCCTTCAAGACCTGCGTTTGGGAGATTTGGTCGAAGAAGATGATGGAAATAAAAAGGATGCACAAGTTTTAGTCAACCTCTCCGTCCACAAGCATGCTAGTTTTGGCTTCTCTGTTGATGGAAGGATCTTAACATCATTCACCAGAAAATGTAGCAACTGCTCCTCTCCATACTGCAGAGAGATTGACACACAGTTTAATGTATGGGTTCTGTCATCAAGCAGAGATGACAACACAATTCAACTACCAGAAATCGGTGGCGACGATCCATCATTAAGTTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

176

Amino Acids

19.78

Weight (kDa)

8.87

Isoelectric Point (pI)

51.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 267
AciI CCGC 1 cut(s) 98
AclWI GGATC 2 cut(s) 380, 506
AfiI CCNNNNNNNGG 2 cut(s) 265, 500
AgsI TTSAA 3 cut(s) 135, 254, 488
AluBI AGCT 2 cut(s) 58, 128
AluI AGCT 2 cut(s) 58, 128
AlwI GGATC 2 cut(s) 380, 506
AspLEI GCGC 1 cut(s) 180
AsuHPI GGTGA 1 cut(s) 379
BccI CCATC 5 cut(s) 200, 207, 284, 359, 523
BclI TGATCA 1 cut(s) 186
BfaI CTAG 1 cut(s) 345
BfmI CTRYAG 1 cut(s) 421
BfuAI ACCTGC 1 cut(s) 267
BmsI GCATC 1 cut(s) 295
BsaXI ACNNNNNCTCC 2 cut(s) 261, 291
Bsc4I CCNNNNNNNGG 2 cut(s) 265, 500
BseGI GGATG 1 cut(s) 310
BseLI CCNNNNNNNGG 2 cut(s) 265, 500
BseMII CTCAG 1 cut(s) 122
BseRI GAGGAG 1 cut(s) 400
BseYI CCCAGC 1 cut(s) 73
BslFI GGGAC 1 cut(s) 232
BslI CCNNNNNNNGG 2 cut(s) 265, 500
BsmFI GGGAC 1 cut(s) 232
Bsp143I GATC 3 cut(s) 186, 372, 511
BspACI CCGC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 121
BspMAI CTGCAG 1 cut(s) 425
BspMI ACCTGC 1 cut(s) 267
BspPI GGATC 2 cut(s) 380, 506
BssMI GATC 3 cut(s) 186, 372, 511
Bst4CI ACNGT 1 cut(s) 441
BstAPI GCANNNNNTGC 1 cut(s) 26
BstC8I GCNNGC 2 cut(s) 176, 342
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 1 cut(s) 310
BstHHI GCGC 1 cut(s) 180
BstKTI GATC 3 cut(s) 189, 375, 514
BstMBI GATC 3 cut(s) 186, 372, 511
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNSI RCATGY 1 cut(s) 344
BstSFI CTRYAG 1 cut(s) 421
BstX2I RGATCY 1 cut(s) 372
BstYI RGATCY 1 cut(s) 372
BtsCI GGATG 1 cut(s) 310
BtsI GCAGTG 1 cut(s) 187
BtsIMutI CAGTG 1 cut(s) 187
BveI ACCTGC 1 cut(s) 267
Cac8I GCNNGC 2 cut(s) 176, 342
CfoI GCGC 1 cut(s) 180
CviAII CATG 2 cut(s) 218, 341
CviJI RGCY 3 cut(s) 58, 128, 354
CviKI_1 RGCY 3 cut(s) 58, 128, 354
DdeI CTNAG 1 cut(s) 108
DpnI GATC 3 cut(s) 188, 374, 513
DpnII GATC 3 cut(s) 186, 372, 511
FaeI CATG 2 cut(s) 221, 344
FaiI YATR 5 cut(s) 68, 219, 342, 418, 451
FaqI GGGAC 1 cut(s) 232
FatI CATG 2 cut(s) 217, 340
FbaI TGATCA 1 cut(s) 186
FokI GGATG 1 cut(s) 317
FspBI CTAG 1 cut(s) 345
GlaI GCGC 1 cut(s) 179
GsaI CCCAGC 1 cut(s) 77
HhaI GCGC 1 cut(s) 180
Hin1II CATG 2 cut(s) 221, 344
Hin6I GCGC 1 cut(s) 178
HinP1I GCGC 1 cut(s) 178
HincII GTYRAC 1 cut(s) 322
HindII GTYRAC 1 cut(s) 322
HindIII AAGCTT 1 cut(s) 56
HinfI GANTC 1 cut(s) 120
HphI GGTGA 1 cut(s) 379
Hpy166II GTNNAC 2 cut(s) 322, 334
Hpy188I TCNGA 6 cut(s) 11, 111, 119, 125, 156, 191
Hpy188III TCNNGA 1 cut(s) 254
Hpy8I GTNNAC 2 cut(s) 322, 334
Hpy99I CGWCG 1 cut(s) 512
HpyAV CCTTC 3 cut(s) 251, 260, 363
HpyCH4III ACNGT 1 cut(s) 441
HpyCH4V TGCA 2 cut(s) 308, 423
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 2 cut(s) 221, 344
HspAI GCGC 1 cut(s) 178
Ksp22I TGATCA 1 cut(s) 186
Kzo9I GATC 3 cut(s) 186, 372, 511
LmnI GCTCC 1 cut(s) 413
LpnPI CCDG 5 cut(s) 87, 160, 272, 403, 507
LweI GCATC 1 cut(s) 295
MaeI CTAG 1 cut(s) 345
MalI GATC 3 cut(s) 188, 374, 513
MboI GATC 3 cut(s) 186, 372, 511
MboII GAAGA 3 cut(s) 123, 293, 296
MflI RGATCY 1 cut(s) 372
MluCI AATT 3 cut(s) 31, 223, 483
MnlI CCTC 3 cut(s) 100, 335, 421
MseI TTAA 4 cut(s) 159, 377, 444, 521
MslI CAYNNNNRTG 1 cut(s) 339
MwoI GCNNNNNNNGC 1 cut(s) 26
NdeII GATC 3 cut(s) 186, 372, 511
NlaIII CATG 2 cut(s) 221, 344
NspI RCATGY 1 cut(s) 344
PaeI GCATGC 1 cut(s) 344
PcsI WCGNNNNNNNCGW 1 cut(s) 507
PfeI GAWTC 1 cut(s) 120
PspFI CCCAGC 1 cut(s) 73
PstI CTGCAG 1 cut(s) 425
PsuI RGATCY 1 cut(s) 372
RseI CAYNNNNRTG 1 cut(s) 339
SaqAI TTAA 4 cut(s) 159, 377, 444, 521
Sau3AI GATC 3 cut(s) 186, 372, 511
SetI ASST 5 cut(s) 60, 130, 243, 261, 327
SfaNI GCATC 1 cut(s) 295
SfcI CTRYAG 1 cut(s) 421
SmiMI CAYNNNNRTG 1 cut(s) 339
SphI GCATGC 1 cut(s) 344
Sse9I AATT 3 cut(s) 31, 223, 483
SsiI CCGC 1 cut(s) 98
SspMI CTAG 1 cut(s) 345
TaaI ACNGT 1 cut(s) 441
TaqI TCGA 1 cut(s) 279
TasI AATT 3 cut(s) 31, 223, 483
TfiI GAWTC 1 cut(s) 120
Tru1I TTAA 4 cut(s) 159, 377, 444, 521
Tru9I TTAA 4 cut(s) 159, 377, 444, 521
TscAI CASTG 1 cut(s) 187
TspGWI ACGGA 1 cut(s) 319
TspRI CASTG 1 cut(s) 187
XceI RCATGY 1 cut(s) 344
XspI CTAG 1 cut(s) 345
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.