Rmu_co8298845.1_g000001

Clathrin interactor EPSIN

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8298845.1
Physical Location & Seq
Reverse (-)
1 .. 834
834 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8298845.1_g000001.1.cds

Sequence Viewer

Length: 371 bp
atgtatagacccggttcttattctgacaaatatgaagatgatcgttatggaggcagggatgaagataggaacggttatggttatggaaaggacaaagaatggggttataaggatgatgaccgttatggaagagctggggattcatatagtcgtgatggagatcgttatggcagagaatatgaggaacgcaatggcagagaaggttacagagatgatgattaccgtggaagaagccgaagtgttgatgaataccagtatggctctagaagtagaagctctgatagagagagagagcgtgcatatgatgatgatggtcaatattcatctcgtggcagtggtgctagagctgatgaccaatctcaggatggaag

Protein Analysis

123

Amino Acids

14.52

Weight (kDa)

4.77

Isoelectric Point (pI)

28.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 108
AfiI CCNNNNNNNGG 1 cut(s) 361
AluBI AGCT 3 cut(s) 134, 276, 347
AluI AGCT 3 cut(s) 134, 276, 347
AsuC2I CCSGG 1 cut(s) 12
BauI CACGAG 1 cut(s) 327
BccI CCATC 3 cut(s) 149, 305, 359
BcnI CCSGG 1 cut(s) 12
BfaI CTAG 2 cut(s) 264, 342
Bme1390I CCNGG 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 12
BpuMI CCSGG 1 cut(s) 12
BsaBI GATNNNNATC 1 cut(s) 159
BsaJI CCNNGG 1 cut(s) 223
Bsc4I CCNNNNNNNGG 1 cut(s) 361
Bse1I ACTGG 1 cut(s) 253
Bse3DI GCAATG 1 cut(s) 196
Bse8I GATNNNNATC 1 cut(s) 159
BseDI CCNNGG 1 cut(s) 223
BseGI GGATG 3 cut(s) 64, 118, 370
BseJI GATNNNNATC 1 cut(s) 159
BseLI CCNNNNNNNGG 1 cut(s) 361
BseMI GCAATG 1 cut(s) 196
BseNI ACTGG 1 cut(s) 253
BseYI CCCAGC 1 cut(s) 134
BsiSI CCGG 1 cut(s) 12
BslI CCNNNNNNNGG 1 cut(s) 361
Bsp143I GATC 2 cut(s) 40, 160
BspQI GCTCTTC 1 cut(s) 124
BsrDI GCAATG 1 cut(s) 196
BsrI ACTGG 1 cut(s) 253
BssECI CCNNGG 1 cut(s) 223
BssMI GATC 2 cut(s) 40, 160
BssSI CACGAG 1 cut(s) 327
Bst2BI CACGAG 1 cut(s) 327
Bst4CI ACNGT 3 cut(s) 74, 122, 224
Bst6I CTCTTC 1 cut(s) 124
BstC8I GCNNGC 1 cut(s) 297
BstDEI CTNAG 1 cut(s) 360
BstDSI CCRYGG 1 cut(s) 223
BstF5I GGATG 3 cut(s) 64, 118, 370
BstKTI GATC 2 cut(s) 43, 163
BstMBI GATC 2 cut(s) 40, 160
BstSCI CCNGG 1 cut(s) 10
BtgI CCRYGG 1 cut(s) 223
BtsCI GGATG 3 cut(s) 64, 118, 370
BtsI GCAGTG 1 cut(s) 340
BtsIMutI CAGTG 1 cut(s) 340
Cac8I GCNNGC 1 cut(s) 297
CviJI RGCY 5 cut(s) 134, 234, 261, 276, 347
CviKI_1 RGCY 5 cut(s) 134, 234, 261, 276, 347
DdeI CTNAG 1 cut(s) 360
DpnI GATC 2 cut(s) 42, 162
DpnII GATC 2 cut(s) 40, 160
Eam1104I CTCTTC 1 cut(s) 124
EarI CTCTTC 1 cut(s) 124
FauNDI CATATG 1 cut(s) 301
FokI GGATG 2 cut(s) 71, 125
FspBI CTAG 2 cut(s) 264, 342
GsaI CCCAGC 1 cut(s) 138
HapII CCGG 1 cut(s) 12
HinfI GANTC 1 cut(s) 140
HpaII CCGG 1 cut(s) 12
Hpy188I TCNGA 2 cut(s) 25, 280
Hpy188III TCNNGA 3 cut(s) 152, 264, 362
HpyAV CCTTC 1 cut(s) 194
HpyCH4III ACNGT 3 cut(s) 74, 122, 224
HpyCH4V TGCA 1 cut(s) 299
HpyF3I CTNAG 1 cut(s) 360
Kzo9I GATC 2 cut(s) 40, 160
LguI GCTCTTC 1 cut(s) 124
LpnPI CCDG 5 cut(s) 25, 40, 120, 266, 347
MaeI CTAG 2 cut(s) 264, 342
MaeIII GTNAC 1 cut(s) 203
MalI GATC 2 cut(s) 42, 162
MboI GATC 2 cut(s) 40, 160
MboII GAAGA 4 cut(s) 47, 74, 141, 240
MnlI CCTC 2 cut(s) 44, 175
MspI CCGG 1 cut(s) 12
MspR9I CCNGG 1 cut(s) 12
NciI CCSGG 1 cut(s) 12
NdeI CATATG 1 cut(s) 301
NdeII GATC 2 cut(s) 40, 160
PciSI GCTCTTC 1 cut(s) 124
PfeI GAWTC 1 cut(s) 140
PsiI TTATAA 1 cut(s) 108
PspFI CCCAGC 1 cut(s) 134
SapI GCTCTTC 1 cut(s) 124
Sau3AI GATC 2 cut(s) 40, 160
ScrFI CCNGG 1 cut(s) 12
SetI ASST 4 cut(s) 136, 205, 278, 349
SspI AATATT 1 cut(s) 320
SspMI CTAG 2 cut(s) 264, 342
StyD4I CCNGG 1 cut(s) 10
TaaI ACNGT 3 cut(s) 74, 122, 224
TfiI GAWTC 1 cut(s) 140
TscAI CASTG 1 cut(s) 340
TspDTI ATGAA 5 cut(s) 48, 75, 132, 261, 312
TspRI CASTG 1 cut(s) 340
XbaI TCTAGA 1 cut(s) 263
XcmI CCANNNNNNNNNTGG 1 cut(s) 362
XspI CTAG 2 cut(s) 264, 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.