Rmu_co8299293.1_g000001

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8299293.1
Physical Location & Seq
Forward (+)
406 .. 762
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8299293.1_g000001.1.cds

Sequence Viewer

Length: 357 bp
atggtggtttggggggaggatgttctacttgatggtttggggaattttcgagcaccatttgcagttcatgtatctaatgtttgctctactaagcacactgagctgttgactattaaggaaggtctcaaactgctgcagactgaaaacgtggtactggaaactgactgtcttgaggcgacctatgatatagctcatgtgcagcatgatttgaatgctttaggcagcctggtggatgatataaagactgccttaaggtctattcgtaatgtttcagtatgccatgctccaagaacttgtaatggagtggcatatagactagcaagtattgcttatgaaaccaggaatagttgtctttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

12.97

Weight (kDa)

5.64

Isoelectric Point (pI)

27.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 43
AfaI GTAC 1 cut(s) 153
AflII CTTAAG 1 cut(s) 250
AgsI TTSAA 1 cut(s) 211
AjnI CCWGG 2 cut(s) 225, 338
AluBI AGCT 2 cut(s) 103, 191
AluI AGCT 2 cut(s) 103, 191
Alw21I GWGCWC 1 cut(s) 55
Alw26I GTCTC 1 cut(s) 128
ApeKI GCWGC 3 cut(s) 133, 199, 222
ApoI RAATTY 1 cut(s) 43
Bbv12I GWGCWC 1 cut(s) 55
BbvI GCAGC 3 cut(s) 120, 211, 234
BccI CCATC 1 cut(s) 26
BciT130I CCWGG 2 cut(s) 227, 340
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 1 cut(s) 317
BfmI CTRYAG 1 cut(s) 134
BfrI CTTAAG 1 cut(s) 250
BisI GCNGC 3 cut(s) 134, 200, 223
BlsI GCNGC 3 cut(s) 135, 201, 224
Bme1390I CCNGG 2 cut(s) 227, 340
BmrFI CCNGG 2 cut(s) 227, 340
BpuEI CTTGAG 1 cut(s) 191
BsaI GGTCTC 1 cut(s) 128
Bse1I ACTGG 1 cut(s) 159
BseBI CCWGG 2 cut(s) 227, 340
BseGI GGATG 2 cut(s) 25, 238
BseMII CTCAG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 159
BseXI GCAGC 3 cut(s) 120, 211, 234
BsgI GTGCAG 1 cut(s) 218
BsiHKAI GWGCWC 1 cut(s) 55
BsmAI GTCTC 1 cut(s) 128
BsmI GAATGC 1 cut(s) 217
Bso31I GGTCTC 1 cut(s) 128
Bsp1286I GDGCHC 1 cut(s) 55
BspCNI CTCAG 1 cut(s) 91
BspMAI CTGCAG 1 cut(s) 138
BspTI CTTAAG 1 cut(s) 250
BspTNI GGTCTC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 159
Bst2UI CCWGG 2 cut(s) 227, 340
Bst4CI ACNGT 1 cut(s) 167
BstAFI CTTAAG 1 cut(s) 250
BstAPI GCANNNNNTGC 2 cut(s) 59, 326
BstDEI CTNAG 2 cut(s) 90, 99
BstF5I GGATG 2 cut(s) 25, 238
BstMAI GTCTC 1 cut(s) 128
BstMWI GCNNNNNNNGC 3 cut(s) 59, 100, 326
BstNI CCWGG 2 cut(s) 227, 340
BstSCI CCNGG 2 cut(s) 225, 338
BstSFI CTRYAG 1 cut(s) 134
BstV1I GCAGC 3 cut(s) 120, 211, 234
BtsCI GGATG 2 cut(s) 25, 238
BtsIMutI CAGTG 1 cut(s) 96
Csp6I GTAC 1 cut(s) 152
CviAII CATG 4 cut(s) 68, 194, 203, 281
CviJI RGCY 3 cut(s) 103, 191, 225
CviKI_1 RGCY 3 cut(s) 103, 191, 225
CviQI GTAC 1 cut(s) 152
DdeI CTNAG 2 cut(s) 90, 99
Eco31I GGTCTC 1 cut(s) 128
EcoRII CCWGG 2 cut(s) 225, 338
FaeI CATG 4 cut(s) 71, 197, 206, 284
FalI AAGNNNNNCTT 4 cut(s) 233, 265, 313, 345
FatI CATG 4 cut(s) 67, 193, 202, 280
Fnu4HI GCNGC 3 cut(s) 134, 200, 223
FokI GGATG 2 cut(s) 32, 245
Fsp4HI GCNGC 3 cut(s) 134, 200, 223
FspBI CTAG 1 cut(s) 317
GluI GCNGC 3 cut(s) 134, 200, 223
Hin1II CATG 4 cut(s) 71, 197, 206, 284
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
Hpy166II GTNNAC 1 cut(s) 108
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 108
HpyAV CCTTC 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 167
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 3 cut(s) 62, 136, 199
HpyF10VI GCNNNNNNNGC 3 cut(s) 59, 100, 326
HpyF3I CTNAG 2 cut(s) 90, 99
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 4 cut(s) 71, 197, 206, 284
LmnI GCTCC 1 cut(s) 289
LpnPI CCDG 5 cut(s) 140, 212, 239, 325, 352
Lsp1109I GCAGC 3 cut(s) 120, 211, 234
MaeI CTAG 1 cut(s) 317
MaeII ACGT 1 cut(s) 147
MhlI GDGCHC 1 cut(s) 55
MluCI AATT 1 cut(s) 43
MnlI CCTC 2 cut(s) 10, 166
MseI TTAA 2 cut(s) 114, 251
MspCI CTTAAG 1 cut(s) 250
MspR9I CCNGG 2 cut(s) 227, 340
Mva1269I GAATGC 1 cut(s) 217
MvaI CCWGG 2 cut(s) 227, 340
MwoI GCNNNNNNNGC 3 cut(s) 59, 100, 326
NlaIII CATG 4 cut(s) 71, 197, 206, 284
PctI GAATGC 1 cut(s) 217
PkrI GCNGC 3 cut(s) 135, 201, 224
Psp6I CCWGG 2 cut(s) 225, 338
PspGI CCWGG 2 cut(s) 225, 338
PstI CTGCAG 1 cut(s) 138
RsaI GTAC 1 cut(s) 153
RsaNI GTAC 1 cut(s) 152
SaqAI TTAA 2 cut(s) 114, 251
SatI GCNGC 3 cut(s) 134, 200, 223
ScrFI CCNGG 2 cut(s) 227, 340
SduI GDGCHC 1 cut(s) 55
SetI ASST 6 cut(s) 105, 124, 150, 182, 193, 257
SfcI CTRYAG 1 cut(s) 134
SmlI CTYRAG 2 cut(s) 170, 250
SmoI CTYRAG 2 cut(s) 170, 250
Sse9I AATT 1 cut(s) 43
SspMI CTAG 1 cut(s) 317
StyD4I CCNGG 2 cut(s) 225, 338
TaaI ACNGT 1 cut(s) 167
TaiI ACGT 1 cut(s) 150
TaqI TCGA 1 cut(s) 49
TasI AATT 1 cut(s) 43
Tru1I TTAA 2 cut(s) 114, 251
Tru9I TTAA 2 cut(s) 114, 251
TscAI CASTG 1 cut(s) 103
TseI GCWGC 3 cut(s) 133, 199, 222
TspDTI ATGAA 2 cut(s) 56, 348
TspRI CASTG 1 cut(s) 103
Vha464I CTTAAG 1 cut(s) 250
XapI RAATTY 1 cut(s) 43
XspI CTAG 1 cut(s) 317
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.