Rmu_co8301417.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8301417.1
Physical Location & Seq
Reverse (-)
1 .. 778
778 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8301417.1_g000001.1.cds

Sequence Viewer

Length: 446 bp
atgcatgattcaactccatcagatgacgagtatcgatcatcgaggaacatagcaatcagtttgttcaggcggtacaggaatgtgcttgaccgtggaggaggtgacaacctaaaagagttcatcagtgcgggggtaaatgcgtatgcactgggatgcacagatgagggattgagaaaagagcttattgatatgaagcaatctggggttgaaattgaagcaatggagagctatagtggaagcaccagtttgaaatccaagattgcatcaggggagattgatgagtgcatcctgtggttgagcattatatttatcaccatcttgtgtacaccacaaccgacaatagttagatggtcatccacacctccagtgtcagatgaagaaaggctcaagtggaaaggtttttgtgcggtcatagcaaacgcttattacttgaggggaatggcatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.51

Weight (kDa)

5.22

Isoelectric Point (pI)

66.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 70, 128, 407
AfaI GTAC 2 cut(s) 74, 325
AgsI TTSAA 4 cut(s) 12, 209, 215, 250
AluBI AGCT 2 cut(s) 181, 228
AluI AGCT 2 cut(s) 181, 228
AsuHPI GGTGA 2 cut(s) 113, 304
BccI CCATC 3 cut(s) 25, 323, 342
BfmI CTRYAG 1 cut(s) 229
BmrI ACTGGG 1 cut(s) 158
BmsI GCATC 3 cut(s) 143, 272, 294
BmuI ACTGGG 1 cut(s) 158
BpmI CTGGAG 1 cut(s) 348
BpuEI CTTGAG 1 cut(s) 371
Bsa29I ATCGAT 1 cut(s) 34
BsaBI GATNNNNATC 1 cut(s) 352
BsaJI CCNNGG 1 cut(s) 91
Bse1I ACTGG 3 cut(s) 153, 243, 365
Bse3DI GCAATG 1 cut(s) 225
Bse8I GATNNNNATC 1 cut(s) 352
BseCI ATCGAT 1 cut(s) 34
BseDI CCNNGG 1 cut(s) 91
BseGI GGATG 3 cut(s) 158, 285, 353
BseJI GATNNNNATC 1 cut(s) 352
BseMI GCAATG 1 cut(s) 225
BseNI ACTGG 3 cut(s) 153, 243, 365
BseRI GAGGAG 1 cut(s) 111
BshVI ATCGAT 1 cut(s) 34
Bsp1407I TGTACA 1 cut(s) 323
Bsp143I GATC 1 cut(s) 35
BspACI CCGC 3 cut(s) 70, 128, 407
BspDI ATCGAT 1 cut(s) 34
BsrDI GCAATG 1 cut(s) 225
BsrGI TGTACA 1 cut(s) 323
BsrI ACTGG 3 cut(s) 153, 243, 365
BssECI CCNNGG 1 cut(s) 91
BssMI GATC 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 92
BstAUI TGTACA 1 cut(s) 323
BstDSI CCRYGG 1 cut(s) 91
BstF5I GGATG 3 cut(s) 158, 285, 353
BstKTI GATC 1 cut(s) 38
BstMBI GATC 1 cut(s) 35
BstMWI GCNNNNNNNGC 1 cut(s) 413
BstSFI CTRYAG 1 cut(s) 229
Bsu15I ATCGAT 1 cut(s) 34
BsuTUI ATCGAT 1 cut(s) 34
BtgI CCRYGG 1 cut(s) 91
BtsCI GGATG 3 cut(s) 158, 285, 353
BtsIMutI CAGTG 3 cut(s) 130, 146, 372
ClaI ATCGAT 1 cut(s) 34
Csp6I GTAC 2 cut(s) 73, 324
CviAII CATG 2 cut(s) 5, 444
CviJI RGCY 3 cut(s) 181, 228, 385
CviKI_1 RGCY 3 cut(s) 181, 228, 385
CviQI GTAC 2 cut(s) 73, 324
DpnI GATC 1 cut(s) 37
DpnII GATC 1 cut(s) 35
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 8
FaiI YATR 8 cut(s) 6, 50, 144, 191, 231, 305, 413, 445
FatI CATG 1 cut(s) 4
FauI CCCGC 1 cut(s) 121
FokI GGATG 3 cut(s) 165, 272, 340
GsuI CTGGAG 1 cut(s) 348
Hin1II CATG 1 cut(s) 8
HinfI GANTC 1 cut(s) 8
HphI GGTGA 2 cut(s) 113, 304
Hpy166II GTNNAC 2 cut(s) 324, 326
Hpy188I TCNGA 2 cut(s) 22, 373
Hpy8I GTNNAC 2 cut(s) 324, 326
HpyCH4III ACNGT 1 cut(s) 92
HpyCH4V TGCA 5 cut(s) 4, 146, 156, 263, 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 413
Hsp92II CATG 1 cut(s) 8
Kzo9I GATC 1 cut(s) 35
LpnPI CCDG 8 cut(s) 52, 61, 134, 186, 252, 256, 302, 378
LweI GCATC 3 cut(s) 143, 272, 294
MaeIII GTNAC 1 cut(s) 101
MalI GATC 1 cut(s) 37
MboI GATC 1 cut(s) 35
MboII GAAGA 1 cut(s) 389
MluCI AATT 1 cut(s) 210
MnlI CCTC 6 cut(s) 36, 89, 92, 157, 372, 426
Mph1103I ATGCAT 1 cut(s) 6
MslI CAYNNNNRTG 1 cut(s) 151
MwoI GCNNNNNNNGC 1 cut(s) 413
NdeII GATC 1 cut(s) 35
NlaIII CATG 1 cut(s) 8
NmuCI GTSAC 1 cut(s) 101
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 8
RsaI GTAC 2 cut(s) 74, 325
RsaNI GTAC 2 cut(s) 73, 324
RseI CAYNNNNRTG 1 cut(s) 151
Sau3AI GATC 1 cut(s) 35
SetI ASST 6 cut(s) 103, 111, 183, 230, 364, 400
SfaNI GCATC 3 cut(s) 143, 272, 294
SfcI CTRYAG 1 cut(s) 229
SmiMI CAYNNNNRTG 1 cut(s) 151
SmlI CTYRAG 2 cut(s) 386, 430
SmoI CTYRAG 2 cut(s) 386, 430
Sse9I AATT 1 cut(s) 210
SsiI CCGC 3 cut(s) 70, 128, 407
TaaI ACNGT 1 cut(s) 92
TaqI TCGA 2 cut(s) 34, 41
TasI AATT 1 cut(s) 210
TatI WGTACW 1 cut(s) 323
TfiI GAWTC 1 cut(s) 8
TscAI CASTG 3 cut(s) 130, 153, 372
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 3 cut(s) 109, 206, 390
TspRI CASTG 3 cut(s) 130, 153, 372
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.