Rmu_co8323009.1_g000001

serine threonine-protein kinase HT1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8323009.1
Physical Location & Seq
Forward (+)
1 .. 953
953 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8323009.1_g000001.1.cds

Sequence Viewer

Length: 604 bp
cttgcagaaagcctcctgtttattgtgtagtcacagaatatttagatgagggttccttgagggcttacttgcacaaacttgagtgcaaatctcttcctttagagaaactaattgccattgccttggacattgctcggggaatggaatacatccactcgcaaggagtcattcaccgggaccttaagcctgagaatgttcttattgataaagactttaggctgaaaattgctgattttggcatagcatgtgaggaggcatactgtgattcattggctgatgaccctggaacttaccgttggatggcccccgaaatgattaagcgtaaatcctatgggcgaaaggttgatgtctacagttttggactcgttttgtgggaactagtagccggaacaatcccttatgaggagatgaatcccattcaagcggcttttgcagttgtgaataagaatttgaggccggttatcccaaagaactgtccacctgctatgcgagccttgatcgagcaatgctggtcgttgcagccggataaaagacccgagttttggcaggttgtaaaggtgctagaacaatttgagtcttcccttgcccgagatggaacattgac
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

201

Amino Acids

22.99

Weight (kDa)

6.0

Isoelectric Point (pI)

42.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 489
Acc36I ACCTGC 2 cut(s) 489, 537
AccI GTMKAC 1 cut(s) 350
AciI CCGC 1 cut(s) 424
AcsI RAATTY 1 cut(s) 447
AfiI CCNNNNNNNGG 3 cut(s) 300, 402, 542
AflII CTTAAG 1 cut(s) 181
AgsI TTSAA 1 cut(s) 421
AhlI ACTAGT 1 cut(s) 378
AjnI CCWGG 1 cut(s) 282
AjuI GAANNNNNNNTTGG 2 cut(s) 279, 311
Ama87I CYCGRG 3 cut(s) 134, 535, 587
AoxI GGCC 2 cut(s) 302, 454
ApeKI GCWGC 1 cut(s) 519
ApoI RAATTY 1 cut(s) 447
ArsI GACNNNNNNTTYG 2 cut(s) 524, 556
AspS9I GGNCC 2 cut(s) 177, 303
AsuC2I CCSGG 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 163
AvaI CYCGRG 3 cut(s) 134, 535, 587
AvaII GGWCC 1 cut(s) 177
BbsI GAAGAC 1 cut(s) 569
BbvI GCAGC 1 cut(s) 531
BccI CCATC 2 cut(s) 294, 586
BciT130I CCWGG 1 cut(s) 284
BcnI CCSGG 1 cut(s) 175
BcuI ACTAGT 1 cut(s) 378
BfaI CTAG 2 cut(s) 379, 562
BfmI CTRYAG 1 cut(s) 351
BfrI CTTAAG 1 cut(s) 181
BfuAI ACCTGC 2 cut(s) 489, 537
BisI GCNGC 2 cut(s) 425, 520
BlsI GCNGC 2 cut(s) 426, 521
Bme1390I CCNGG 2 cut(s) 175, 284
Bme18I GGWCC 1 cut(s) 177
BmeT110I CYCGRG 3 cut(s) 134, 535, 587
BmgT120I GGNCC 2 cut(s) 177, 303
BmiI GGNNCC 3 cut(s) 54, 178, 305
BmrFI CCNGG 2 cut(s) 175, 284
BpiI GAAGAC 1 cut(s) 569
BpuEI CTTGAG 2 cut(s) 78, 100
BpuMI CCSGG 1 cut(s) 175
BsaJI CCNNGG 2 cut(s) 122, 282
Bsc4I CCNNNNNNNGG 3 cut(s) 300, 402, 542
Bse118I RCCGGY 1 cut(s) 456
Bse3DI GCAATG 3 cut(s) 116, 128, 511
BseBI CCWGG 1 cut(s) 284
BseDI CCNNGG 2 cut(s) 122, 282
BseGI GGATG 2 cut(s) 149, 305
BseLI CCNNNNNNNGG 3 cut(s) 300, 402, 542
BseMI GCAATG 3 cut(s) 116, 128, 511
BseMII CTCAG 1 cut(s) 179
BseRI GAGGAG 2 cut(s) 265, 418
BseXI GCAGC 1 cut(s) 531
BshFI GGCC 2 cut(s) 304, 456
BsiHKCI CYCGRG 3 cut(s) 134, 535, 587
BsiSI CCGG 4 cut(s) 174, 386, 457, 523
BslFI GGGAC 1 cut(s) 190
BslI CCNNNNNNNGG 3 cut(s) 300, 402, 542
BsmFI GGGAC 1 cut(s) 190
BsnI GGCC 2 cut(s) 304, 456
BsoBI CYCGRG 3 cut(s) 134, 535, 587
Bsp143I GATC 1 cut(s) 497
BspACI CCGC 1 cut(s) 424
BspANI GGCC 2 cut(s) 304, 456
BspCNI CTCAG 1 cut(s) 180
BspLI GGNNCC 3 cut(s) 54, 178, 305
BspMI ACCTGC 2 cut(s) 489, 537
BspTI CTTAAG 1 cut(s) 181
BsrDI GCAATG 3 cut(s) 116, 128, 511
BsrFI RCCGGY 1 cut(s) 456
BssAI RCCGGY 1 cut(s) 456
BssECI CCNNGG 2 cut(s) 122, 282
BssMI GATC 1 cut(s) 497
BssT1I CCWWGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 284
Bst4CI ACNGT 4 cut(s) 262, 295, 355, 475
Bst6I CTCTTC 1 cut(s) 98
BstAFI CTTAAG 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 491
BstDEI CTNAG 1 cut(s) 188
BstF5I GGATG 2 cut(s) 149, 305
BstKTI GATC 1 cut(s) 500
BstMBI GATC 1 cut(s) 497
BstMWI GCNNNNNNNGC 2 cut(s) 430, 490
BstNI CCWGG 1 cut(s) 284
BstNSI RCATGY 1 cut(s) 248
BstSCI CCNGG 2 cut(s) 173, 282
BstSFI CTRYAG 1 cut(s) 351
BstV1I GCAGC 1 cut(s) 531
BstV2I GAAGAC 1 cut(s) 569
BstXI CCANNNNNNTGG 1 cut(s) 123
BsuRI GGCC 2 cut(s) 304, 456
BtsCI GGATG 2 cut(s) 149, 305
BveI ACCTGC 2 cut(s) 489, 537
Cac8I GCNNGC 1 cut(s) 491
Cfr10I RCCGGY 1 cut(s) 456
Cfr13I GGNCC 2 cut(s) 177, 303
CviAII CATG 1 cut(s) 245
DdeI CTNAG 1 cut(s) 188
DpnI GATC 1 cut(s) 499
DpnII GATC 1 cut(s) 497
Eam1104I CTCTTC 1 cut(s) 98
EarI CTCTTC 1 cut(s) 98
Eco130I CCWWGG 1 cut(s) 122
Eco47I GGWCC 1 cut(s) 177
Eco88I CYCGRG 3 cut(s) 134, 535, 587
EcoO109I RGGNCCY 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 282
EcoT14I CCWWGG 1 cut(s) 122
ErhI CCWWGG 1 cut(s) 122
FaeI CATG 1 cut(s) 248
FaiI YATR 6 cut(s) 241, 246, 258, 332, 401, 487
FaqI GGGAC 1 cut(s) 190
FatI CATG 1 cut(s) 244
FblI GTMKAC 1 cut(s) 350
Fnu4HI GCNGC 2 cut(s) 425, 520
FokI GGATG 2 cut(s) 136, 312
Fsp4HI GCNGC 2 cut(s) 425, 520
FspBI CTAG 2 cut(s) 379, 562
GluI GCNGC 2 cut(s) 425, 520
HaeIII GGCC 2 cut(s) 304, 456
HapII CCGG 4 cut(s) 174, 386, 457, 523
Hin1II CATG 1 cut(s) 248
HinfI GANTC 5 cut(s) 164, 265, 362, 411, 574
HpaII CCGG 4 cut(s) 174, 386, 457, 523
HphI GGTGA 1 cut(s) 163
Hpy166II GTNNAC 2 cut(s) 351, 478
Hpy8I GTNNAC 2 cut(s) 351, 478
HpyCH4III ACNGT 4 cut(s) 262, 295, 355, 475
HpyCH4V TGCA 5 cut(s) 5, 72, 86, 433, 519
HpyF10VI GCNNNNNNNGC 2 cut(s) 430, 490
HpyF3I CTNAG 1 cut(s) 188
Hsp92II CATG 1 cut(s) 248
Kzo9I GATC 1 cut(s) 497
Lsp1109I GCAGC 1 cut(s) 531
MaeI CTAG 2 cut(s) 379, 562
MaeIII GTNAC 1 cut(s) 30
MalI GATC 1 cut(s) 499
MboI GATC 1 cut(s) 497
MboII GAAGA 2 cut(s) 85, 569
MluCI AATT 4 cut(s) 110, 224, 447, 568
MlyI GAGTC 3 cut(s) 173, 356, 583
MmeI TCCRAC 1 cut(s) 277
MnlI CCTC 7 cut(s) 23, 42, 53, 243, 246, 396, 446
MseI TTAA 2 cut(s) 182, 317
MspCI CTTAAG 1 cut(s) 181
MspI CCGG 4 cut(s) 174, 386, 457, 523
MspR9I CCNGG 2 cut(s) 175, 284
MvaI CCWGG 1 cut(s) 284
MwoI GCNNNNNNNGC 2 cut(s) 430, 490
NciI CCSGG 1 cut(s) 175
NdeII GATC 1 cut(s) 497
NlaIII CATG 1 cut(s) 248
NlaIV GGNNCC 3 cut(s) 54, 178, 305
NmuCI GTSAC 1 cut(s) 30
NspI RCATGY 1 cut(s) 248
PaqCI CACCTGC 1 cut(s) 489
PfeI GAWTC 2 cut(s) 265, 411
PkrI GCNGC 2 cut(s) 426, 521
PleI GAGTC 3 cut(s) 172, 356, 582
PpsI GAGTC 3 cut(s) 172, 356, 582
PpuMI RGGWCCY 1 cut(s) 177
Psp5II RGGWCCY 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 282
PspGI CCWGG 1 cut(s) 282
PspN4I GGNNCC 3 cut(s) 54, 178, 305
PspPI GGNCC 2 cut(s) 177, 303
PspPPI RGGWCCY 1 cut(s) 177
SaqAI TTAA 2 cut(s) 182, 317
SatI GCNGC 2 cut(s) 425, 520
Sau3AI GATC 1 cut(s) 497
Sau96I GGNCC 2 cut(s) 177, 303
SchI GAGTC 3 cut(s) 173, 356, 583
ScrFI CCNGG 2 cut(s) 175, 284
SetI ASST 5 cut(s) 182, 344, 483, 551, 560
SfcI CTRYAG 1 cut(s) 351
SinI GGWCC 1 cut(s) 177
SmlI CTYRAG 3 cut(s) 57, 79, 181
SmoI CTYRAG 3 cut(s) 57, 79, 181
SpeI ACTAGT 1 cut(s) 378
Sse9I AATT 4 cut(s) 110, 224, 447, 568
SsiI CCGC 1 cut(s) 424
SspI AATATT 1 cut(s) 40
SspMI CTAG 2 cut(s) 379, 562
StyD4I CCNGG 2 cut(s) 173, 282
StyI CCWWGG 1 cut(s) 122
TaaI ACNGT 4 cut(s) 262, 295, 355, 475
TaqI TCGA 1 cut(s) 500
TasI AATT 4 cut(s) 110, 224, 447, 568
TauI GCSGC 1 cut(s) 427
TfiI GAWTC 2 cut(s) 265, 411
Tru1I TTAA 2 cut(s) 182, 317
Tru9I TTAA 2 cut(s) 182, 317
TseFI GTSAC 1 cut(s) 30
TseI GCWGC 1 cut(s) 519
Tsp45I GTSAC 1 cut(s) 30
TspDTI ATGAA 2 cut(s) 257, 424
Vha464I CTTAAG 1 cut(s) 181
VpaK11BI GGWCC 1 cut(s) 177
XapI RAATTY 1 cut(s) 447
XceI RCATGY 1 cut(s) 248
XmiI GTMKAC 1 cut(s) 350
XspI CTAG 2 cut(s) 379, 562
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.