Rorug04G0436800

serine threonine-protein kinase HT1-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
59420040 .. 59422689
2650 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0436800.1

Sequence Viewer

Length: 213 bp
ATGCCGATTGGGAGTTCATTTCCGAGGAGCACGAACGATGCGGAGCTAGATGCCCATAACTGGGGAGTTGTCACAACAAAACATCGAAGATCGTTGTTGATTTCGACTGAAATTATAGAGCGGAAATTCATAATAGAAATTTGGTCTCGTTTTTCCAATTATGAAGTGATCCTACTCACATTGGACCTAGTGCCCAGGTGGTTTGGCCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.2

Weight (kDa)

6.72

Isoelectric Point (pI)

72.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 121
AciI CCGC 2 cut(s) 41, 121
AclWI GGATC 1 cut(s) 163
AcoI YGGCCR 1 cut(s) 205
AcsI RAATTY 2 cut(s) 125, 138
AfiI CCNNNNNNNGG 2 cut(s) 60, 61
AjnI CCWGG 1 cut(s) 194
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
Alw21I GWGCWC 1 cut(s) 32
Alw26I GTCTC 1 cut(s) 150
AlwI GGATC 1 cut(s) 163
AoxI GGCC 1 cut(s) 205
ApoI RAATTY 2 cut(s) 125, 138
AspS9I GGNCC 1 cut(s) 184
AvaII GGWCC 1 cut(s) 184
BaeGI GKGCMC 1 cut(s) 195
BalI TGGCCA 1 cut(s) 207
BarI GAAGNNNNNNTAC 2 cut(s) 156, 188
Bbv12I GWGCWC 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 196
BcoDI GTCTC 1 cut(s) 150
BfaI CTAG 2 cut(s) 47, 188
Bme1390I CCNGG 1 cut(s) 196
Bme18I GGWCC 1 cut(s) 184
BmgT120I GGNCC 1 cut(s) 184
BmrFI CCNGG 1 cut(s) 196
BmrI ACTGGG 1 cut(s) 70
BmsI GCATC 2 cut(s) 28, 40
BmuI ACTGGG 1 cut(s) 70
BsaI GGTCTC 1 cut(s) 150
BsaJI CCNNGG 2 cut(s) 23, 194
Bsc4I CCNNNNNNNGG 2 cut(s) 60, 61
Bse1I ACTGG 1 cut(s) 65
BseBI CCWGG 1 cut(s) 196
BseDI CCNNGG 2 cut(s) 23, 194
BseLI CCNNNNNNNGG 2 cut(s) 60, 61
BseNI ACTGG 1 cut(s) 65
BseRI GAGGAG 1 cut(s) 40
BseSI GKGCMC 1 cut(s) 195
BshFI GGCC 1 cut(s) 207
BsiHKAI GWGCWC 1 cut(s) 32
BslI CCNNNNNNNGG 2 cut(s) 60, 61
BsmAI GTCTC 1 cut(s) 150
BsnI GGCC 1 cut(s) 207
Bso31I GGTCTC 1 cut(s) 150
Bsp1286I GDGCHC 2 cut(s) 32, 195
Bsp143I GATC 2 cut(s) 89, 168
BspACI CCGC 2 cut(s) 41, 121
BspANI GGCC 1 cut(s) 207
BspPI GGATC 1 cut(s) 163
BspTNI GGTCTC 1 cut(s) 150
BsrBI CCGCTC 1 cut(s) 121
BsrI ACTGG 1 cut(s) 65
BssECI CCNNGG 2 cut(s) 23, 194
BssMI GATC 2 cut(s) 89, 168
Bst2UI CCWGG 1 cut(s) 196
BstKTI GATC 2 cut(s) 92, 171
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 2 cut(s) 89, 168
BstNI CCWGG 1 cut(s) 196
BstSCI CCNGG 1 cut(s) 194
BstSLI GKGCMC 1 cut(s) 195
BsuRI GGCC 1 cut(s) 207
Cfr13I GGNCC 1 cut(s) 184
CviJI RGCY 2 cut(s) 46, 207
CviKI_1 RGCY 2 cut(s) 46, 207
DpnI GATC 2 cut(s) 91, 170
DpnII GATC 2 cut(s) 89, 168
EaeI YGGCCR 1 cut(s) 205
Eco31I GGTCTC 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 184
EcoRII CCWGG 1 cut(s) 194
FaiI YATR 4 cut(s) 57, 116, 131, 162
FspBI CTAG 2 cut(s) 47, 188
HaeIII GGCC 1 cut(s) 207
Hpy188I TCNGA 1 cut(s) 24
Kzo9I GATC 2 cut(s) 89, 168
LmnI GCTCC 2 cut(s) 27, 43
LpnPI CCDG 3 cut(s) 46, 181, 208
LweI GCATC 2 cut(s) 28, 40
MaeI CTAG 2 cut(s) 47, 188
MaeIII GTNAC 1 cut(s) 70
MalI GATC 2 cut(s) 91, 170
MbiI CCGCTC 1 cut(s) 121
MboI GATC 2 cut(s) 89, 168
MboII GAAGA 1 cut(s) 99
MhlI GDGCHC 2 cut(s) 32, 195
MlsI TGGCCA 1 cut(s) 207
MluCI AATT 4 cut(s) 111, 125, 138, 157
MluNI TGGCCA 1 cut(s) 207
MnlI CCTC 1 cut(s) 18
Mox20I TGGCCA 1 cut(s) 207
MscI TGGCCA 1 cut(s) 207
Msp20I TGGCCA 1 cut(s) 207
MspR9I CCNGG 1 cut(s) 196
MvaI CCWGG 1 cut(s) 196
NdeII GATC 2 cut(s) 89, 168
NmuCI GTSAC 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 194
PspGI CCWGG 1 cut(s) 194
PspPI GGNCC 1 cut(s) 184
Sau3AI GATC 2 cut(s) 89, 168
Sau96I GGNCC 1 cut(s) 184
ScrFI CCNGG 1 cut(s) 196
SduI GDGCHC 2 cut(s) 32, 195
SetI ASST 3 cut(s) 48, 189, 200
SfaNI GCATC 2 cut(s) 28, 40
SgeI CNNG 8 cut(s) 36, 43, 59, 73, 159, 200, 207, 208
SinI GGWCC 1 cut(s) 184
Sse9I AATT 4 cut(s) 111, 125, 138, 157
SsiI CCGC 2 cut(s) 41, 121
SspMI CTAG 2 cut(s) 47, 188
StyD4I CCNGG 1 cut(s) 194
TaqI TCGA 2 cut(s) 85, 104
TasI AATT 4 cut(s) 111, 125, 138, 157
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
TspDTI ATGAA 3 cut(s) 6, 118, 177
VpaK11BI GGWCC 1 cut(s) 184
XapI RAATTY 2 cut(s) 125, 138
XspI CTAG 2 cut(s) 47, 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.