Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8341691.1

Orthogroup ID

OG0003914

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 613

Gene Structure 613 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8341691.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 231 bp

atggagaatcacagcaaaacccagcttcaaagtttcctcaaacatcttcctcctgttgagttctgctgtgtttatgggtcatcactacacccaaatcgtgacaatgccaagtcaacaatggtggattgcattcttggagtatcagatcccctacaatggcattctgagaatctgaaattgaacaaggatcactatgcctcttggatgtcgctgctgggtggggccagactg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mmp37

Protein Analysis

77

Amino Acids

8.73

Weight (kDa)

6.95

Isoelectric Point (pI)

53.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003914)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G47630 AT3G47630 AT3G47630 AT3G47630 AT3G47630 AT3G47630
fragaria_vesca	FvH4_3g13050
malus_domestica	MD05G1245400.v1.1
prunus_persica	Prupe.4G118500_v2.0.a1 Prupe.4G118500_v2.0.a1 Prupe.4G118500_v2.0.a1 Prupe.4G118500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1 Prupe.7G025500_v2.0.a1
pyrus_communis	pycom05g22150
rosa_chinensis	RchiOBHm_Chr5g0021241
rosa_laevigata	RLG00000032598
rosa_multiflora	Rmu_co8341691.1_g000001
rosa_roxburghii	Rroxscaffold_1G00057260
rosa_rugosa	Rorug05G0065400 Rorug05G0065500
rosa_samantha	Rh5AG154500 Rh5BG154100 Rh5CG167700 Rh5DG154600
rosa_wichuraiana	Rw5G013770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	140, 195
AfiI	CCNNNNNNNGG	1 cut(s)	156
AgsI	TTSAA	2 cut(s)	29, 181
AluBI	AGCT	1 cut(s)	25
AluI	AGCT	1 cut(s)	25
AlwI	GGATC	2 cut(s)	140, 195
AoxI	GGCC	1 cut(s)	222
ApeKI	GCWGC	1 cut(s)	211
AspS9I	GGNCC	1 cut(s)	222
BbvI	GCAGC	1 cut(s)	198
BisI	GCNGC	1 cut(s)	212
BlsI	GCNGC	1 cut(s)	213
BmgT120I	GGNCC	1 cut(s)	222
BmiI	GGNNCC	1 cut(s)	223
Bsc4I	CCNNNNNNNGG	1 cut(s)	156
BseGI	GGATG	1 cut(s)	210
BseLI	CCNNNNNNNGG	1 cut(s)	156
BseMII	CTCAG	1 cut(s)	156
BseXI	GCAGC	1 cut(s)	198
BseYI	CCCAGC	2 cut(s)	21, 214
BshFI	GGCC	1 cut(s)	224
BslI	CCNNNNNNNGG	1 cut(s)	156
BsmI	GAATGC	2 cut(s)	129, 160
BsnI	GGCC	1 cut(s)	224
Bsp143I	GATC	2 cut(s)	145, 187
BspANI	GGCC	1 cut(s)	224
BspCNI	CTCAG	1 cut(s)	157
BspLI	GGNNCC	1 cut(s)	223
BspPI	GGATC	2 cut(s)	140, 195
BssMI	GATC	2 cut(s)	145, 187
BstDEI	CTNAG	1 cut(s)	165
BstF5I	GGATG	1 cut(s)	210
BstKTI	GATC	2 cut(s)	148, 190
BstMBI	GATC	2 cut(s)	145, 187
BstV1I	GCAGC	1 cut(s)	198
BstX2I	RGATCY	1 cut(s)	145
BstYI	RGATCY	1 cut(s)	145
BsuRI	GGCC	1 cut(s)	224
BtsCI	GGATG	1 cut(s)	210
Cfr13I	GGNCC	1 cut(s)	222
CspCI	CAANNNNNGTGG	2 cut(s)	102, 137
CviJI	RGCY	2 cut(s)	25, 224
CviKI_1	RGCY	2 cut(s)	25, 224
DdeI	CTNAG	1 cut(s)	165
DpnI	GATC	2 cut(s)	147, 189
DpnII	GATC	2 cut(s)	145, 187
FaiI	YATR	2 cut(s)	75, 195
Fnu4HI	GCNGC	1 cut(s)	212
FokI	GGATG	1 cut(s)	217
Fsp4HI	GCNGC	1 cut(s)	212
GluI	GCNGC	1 cut(s)	212
GsaI	CCCAGC	2 cut(s)	25, 218
HaeIII	GGCC	1 cut(s)	224
HincII	GTYRAC	1 cut(s)	114
HindII	GTYRAC	1 cut(s)	114
HinfI	GANTC	2 cut(s)	7, 169
Hpy166II	GTNNAC	1 cut(s)	114
Hpy188I	TCNGA	3 cut(s)	145, 166, 174
Hpy188III	TCNNGA	1 cut(s)	98
Hpy8I	GTNNAC	1 cut(s)	114
HpyCH4V	TGCA	1 cut(s)	129
HpyF3I	CTNAG	1 cut(s)	165
Kzo9I	GATC	2 cut(s)	145, 187
LpnPI	CCDG	3 cut(s)	35, 66, 200
Lsp1109I	GCAGC	1 cut(s)	198
MaeIII	GTNAC	1 cut(s)	98
MalI	GATC	2 cut(s)	147, 189
MboI	GATC	2 cut(s)	145, 187
MboII	GAAGA	1 cut(s)	38
MflI	RGATCY	1 cut(s)	145
MluCI	AATT	1 cut(s)	176
MnlI	CCTC	3 cut(s)	47, 60, 208
Mva1269I	GAATGC	2 cut(s)	129, 160
NdeII	GATC	2 cut(s)	145, 187
NlaIV	GGNNCC	1 cut(s)	223
NmuCI	GTSAC	1 cut(s)	98
PctI	GAATGC	2 cut(s)	129, 160
PfeI	GAWTC	2 cut(s)	7, 169
PkrI	GCNGC	1 cut(s)	213
PspFI	CCCAGC	2 cut(s)	21, 214
PspN4I	GGNNCC	1 cut(s)	223
PspPI	GGNCC	1 cut(s)	222
PsuI	RGATCY	1 cut(s)	145
SatI	GCNGC	1 cut(s)	212
Sau3AI	GATC	2 cut(s)	145, 187
Sau96I	GGNCC	1 cut(s)	222
SetI	ASST	1 cut(s)	27
SgeI	CNNG	8 cut(s)	34, 65, 110, 121, 146, 196, 213, 227
Sse9I	AATT	1 cut(s)	176
TasI	AATT	1 cut(s)	176
TfiI	GAWTC	2 cut(s)	7, 169
TseFI	GTSAC	1 cut(s)	98
TseI	GCWGC	1 cut(s)	211
Tsp45I	GTSAC	1 cut(s)	98
XcmI	CCANNNNNNNNNTGG	1 cut(s)	115

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.