Rmu_co8350645.1_g000001

Belongs to the GRAS family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8350645.1
Physical Location & Seq
Reverse (-)
2 .. 293
292 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8350645.1_g000001.1.cds

Sequence Viewer

Length: 292 bp
atgaagcgaaatcaccaagtcagttgcggcggaggtcaaaatggtagcaatacgtccgtctctaatagtagcaaggccaaaatttgggaggaggagcaagaatctggaagcatggatgagttattggccgttttgggctataaagtcaggtccgatgacatggcggatgtggccgagaagcttgaacagcttgagatggtcatgggttcagctcaacaagatgggatttcacagctttccgatacagttcattacaacccatccgatctctccggctggctccagaccatgc

Protein Analysis

97

Amino Acids

10.58

Weight (kDa)

4.46

Isoelectric Point (pI)

50.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 84
AciI CCGC 3 cut(s) 27, 30, 164
AcoI YGGCCR 2 cut(s) 126, 171
AcsI RAATTY 1 cut(s) 81
AfiI CCNNNNNNNGG 1 cut(s) 84
AgsI TTSAA 1 cut(s) 185
AluBI AGCT 4 cut(s) 181, 190, 212, 235
AluI AGCT 4 cut(s) 181, 190, 212, 235
Alw26I GTCTC 1 cut(s) 64
AoxI GGCC 3 cut(s) 75, 126, 171
ApoI RAATTY 1 cut(s) 81
AspS9I GGNCC 1 cut(s) 150
AsuHPI GGTGA 1 cut(s) 5
AvaII GGWCC 1 cut(s) 150
BccI CCATC 3 cut(s) 190, 215, 268
BceAI ACGGC 1 cut(s) 113
BcoDI GTCTC 1 cut(s) 64
BisI GCNGC 1 cut(s) 28
BlsI GCNGC 1 cut(s) 29
Bme18I GGWCC 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 150
BmiI GGNNCC 1 cut(s) 281
BpmI CTGGAG 1 cut(s) 266
BpuEI CTTGAG 1 cut(s) 212
Bsc4I CCNNNNNNNGG 1 cut(s) 84
BseGI GGATG 3 cut(s) 121, 172, 260
BseLI CCNNNNNNNGG 1 cut(s) 84
BseRI GAGGAG 2 cut(s) 104, 107
BshFI GGCC 3 cut(s) 77, 128, 173
BsiSI CCGG 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 84
BsmAI GTCTC 1 cut(s) 64
BsmBI CGTCTC 1 cut(s) 64
BsnI GGCC 3 cut(s) 77, 128, 173
Bsp143I GATC 1 cut(s) 265
BspACI CCGC 3 cut(s) 27, 30, 164
BspANI GGCC 3 cut(s) 77, 128, 173
BspLI GGNNCC 1 cut(s) 281
BssMI GATC 1 cut(s) 265
Bst4CI ACNGT 1 cut(s) 247
BstC8I GCNNGC 1 cut(s) 278
BstF5I GGATG 3 cut(s) 121, 172, 260
BstKTI GATC 1 cut(s) 268
BstMAI GTCTC 1 cut(s) 64
BstMBI GATC 1 cut(s) 265
BstMWI GCNNNNNNNGC 2 cut(s) 170, 187
BsuRI GGCC 3 cut(s) 77, 128, 173
BtsCI GGATG 3 cut(s) 121, 172, 260
Cac8I GCNNGC 1 cut(s) 278
Cfr13I GGNCC 1 cut(s) 150
CviAII CATG 4 cut(s) 112, 160, 202, 289
DpnI GATC 1 cut(s) 267
DpnII GATC 1 cut(s) 265
EaeI YGGCCR 2 cut(s) 126, 171
EciI GGCGGA 2 cut(s) 45, 179
Eco47I GGWCC 1 cut(s) 150
Esp3I CGTCTC 1 cut(s) 64
FaeI CATG 4 cut(s) 115, 163, 205, 292
FaiI YATR 5 cut(s) 113, 141, 161, 203, 290
FatI CATG 4 cut(s) 111, 159, 201, 288
Fnu4HI GCNGC 1 cut(s) 28
FokI GGATG 3 cut(s) 128, 179, 247
Fsp4HI GCNGC 1 cut(s) 28
GluI GCNGC 1 cut(s) 28
GsuI CTGGAG 1 cut(s) 266
HaeIII GGCC 3 cut(s) 77, 128, 173
HapII CCGG 1 cut(s) 273
Hin1II CATG 4 cut(s) 115, 163, 205, 292
HindIII AAGCTT 1 cut(s) 179
HinfI GANTC 1 cut(s) 101
HpaII CCGG 1 cut(s) 273
HphI GGTGA 1 cut(s) 5
Hpy188I TCNGA 3 cut(s) 154, 241, 265
Hpy188III TCNNGA 2 cut(s) 105, 283
HpyCH4III ACNGT 1 cut(s) 247
HpyCH4IV ACGT 1 cut(s) 53
HpyF10VI GCNNNNNNNGC 2 cut(s) 170, 187
HpySE526I ACGT 1 cut(s) 53
Hsp92II CATG 4 cut(s) 115, 163, 205, 292
Kzo9I GATC 1 cut(s) 265
LmnI GCTCC 2 cut(s) 94, 285
LpnPI CCDG 4 cut(s) 90, 133, 262, 286
MaeII ACGT 1 cut(s) 53
MalI GATC 1 cut(s) 267
MboI GATC 1 cut(s) 265
MluCI AATT 1 cut(s) 81
MnlI CCTC 3 cut(s) 26, 82, 85
MspI CCGG 1 cut(s) 273
MwoI GCNNNNNNNGC 2 cut(s) 170, 187
NdeII GATC 1 cut(s) 265
NlaIII CATG 4 cut(s) 115, 163, 205, 292
NlaIV GGNNCC 1 cut(s) 281
NmeAIII GCCGAG 1 cut(s) 199
PfeI GAWTC 1 cut(s) 101
PflMI CCANNNNNTGG 1 cut(s) 84
PkrI GCNGC 1 cut(s) 29
PspN4I GGNNCC 1 cut(s) 281
PspPI GGNCC 1 cut(s) 150
SatI GCNGC 1 cut(s) 28
Sau3AI GATC 1 cut(s) 265
Sau96I GGNCC 1 cut(s) 150
SetI ASST 7 cut(s) 37, 56, 152, 183, 192, 214, 237
SinI GGWCC 1 cut(s) 150
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
Sse9I AATT 1 cut(s) 81
SsiI CCGC 3 cut(s) 27, 30, 164
TaaI ACNGT 1 cut(s) 247
TaiI ACGT 1 cut(s) 56
TasI AATT 1 cut(s) 81
TauI GCSGC 1 cut(s) 30
TfiI GAWTC 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 17, 239
TspGWI ACGGA 1 cut(s) 46
Van91I CCANNNNNTGG 1 cut(s) 84
VpaK11BI GGWCC 1 cut(s) 150
XapI RAATTY 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.