Rmu_co8356493.1_g000001

phosphatase 2c

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8356493.1
Physical Location & Seq
Reverse (-)
410 .. 961
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8356493.1_g000001.1.cds

Sequence Viewer

Length: 552 bp
atgctaatcgctaatgctggtgattgtcgagctgtattggggaagcgcggaagagcaattgaactatctaaagatcacaaacctaattgcacctctgaaagattaagaatcgagaagctgggtggtgtcatctatgatggatacctcaatggccaactatcagtggcgcgtgctcttggagactggcatatcaagggttcgaaaggttcaaactgccccttaagctctgagccagagttggaggaaattgtcctaaccgaggaggatgaattcttgataatgggatgtgatggcttgtgggatgtgatgagcagccagtgtgctgtcacaatggtaagaaaggagctcatgcagcataatgatcctgagagatgttcgaaagtacttgtcaaggaggcactccaacgaaacacatgtgacaacctgactgtagtggtggtgtgtttctccgaagaccctcctcctaagaccgaaattcctaaatcccacaagaggaggagcatttcagctgaagggttggaccttctcaagggtgtcttgagcagcatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

20.18

Weight (kDa)

5.85

Isoelectric Point (pI)

59.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 48, 169
AciI CCGC 1 cut(s) 48
AclWI GGATC 1 cut(s) 356
AcoI YGGCCR 1 cut(s) 151
AcsI RAATTY 2 cut(s) 269, 474
AcuI CTGAAG 1 cut(s) 531
AfaI GTAC 1 cut(s) 384
AfiI CCNNNNNNNGG 3 cut(s) 259, 492, 529
AflII CTTAAG 1 cut(s) 220
AflIII ACRYGT 1 cut(s) 413
AgsI TTSAA 2 cut(s) 62, 210
AluBI AGCT 5 cut(s) 32, 118, 225, 346, 509
AluI AGCT 5 cut(s) 32, 118, 225, 346, 509
Alw21I GWGCWC 2 cut(s) 175, 348
Alw26I GTCTC 1 cut(s) 174
AlwI GGATC 1 cut(s) 356
AoxI GGCC 1 cut(s) 151
ApeKI GCWGC 3 cut(s) 312, 352, 543
ApoI RAATTY 2 cut(s) 269, 474
AspLEI GCGC 2 cut(s) 48, 169
AspS9I GGNCC 1 cut(s) 520
AsuHPI GGTGA 1 cut(s) 32
AsuII TTCGAA 2 cut(s) 200, 377
AvaII GGWCC 1 cut(s) 520
BalI TGGCCA 1 cut(s) 153
BanII GRGCYC 1 cut(s) 348
BbsI GAAGAC 1 cut(s) 459
Bbv12I GWGCWC 2 cut(s) 175, 348
BbvI GCAGC 2 cut(s) 324, 364
BccI CCATC 2 cut(s) 131, 284
BciVI GTATCC 1 cut(s) 134
BcoDI GTCTC 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 429
BfrI CTTAAG 1 cut(s) 220
BfuI GTATCC 1 cut(s) 134
BisI GCNGC 3 cut(s) 313, 353, 544
BlsI GCNGC 3 cut(s) 314, 354, 545
BmcAI AGTACT 1 cut(s) 384
Bme18I GGWCC 1 cut(s) 520
BmgT120I GGNCC 1 cut(s) 520
BpiI GAAGAC 1 cut(s) 459
Bpu14I TTCGAA 2 cut(s) 200, 377
BpuEI CTTGAG 1 cut(s) 512
BsaJI CCNNGG 1 cut(s) 258
Bsc4I CCNNNNNNNGG 3 cut(s) 259, 492, 529
Bse1I ACTGG 2 cut(s) 188, 316
BseDI CCNNGG 1 cut(s) 258
BseGI GGATG 3 cut(s) 271, 290, 307
BseLI CCNNNNNNNGG 3 cut(s) 259, 492, 529
BseMII CTCAG 2 cut(s) 219, 357
BseNI ACTGG 2 cut(s) 188, 316
BseRI GAGGAG 4 cut(s) 275, 450, 508, 511
BseXI GCAGC 2 cut(s) 324, 364
BseYI CCCAGC 1 cut(s) 118
Bsh1236I CGCG 2 cut(s) 48, 169
BshFI GGCC 1 cut(s) 153
BsiHKAI GWGCWC 2 cut(s) 175, 348
BslI CCNNNNNNNGG 3 cut(s) 259, 492, 529
BsmAI GTCTC 1 cut(s) 174
BsnI GGCC 1 cut(s) 153
Bsp119I TTCGAA 2 cut(s) 200, 377
Bsp1286I GDGCHC 2 cut(s) 175, 348
Bsp143I GATC 2 cut(s) 73, 361
BspACI CCGC 1 cut(s) 48
BspANI GGCC 1 cut(s) 153
BspCNI CTCAG 2 cut(s) 220, 358
BspFNI CGCG 2 cut(s) 48, 169
BspPI GGATC 1 cut(s) 356
BspQI GCTCTTC 1 cut(s) 46
BspT104I TTCGAA 2 cut(s) 200, 377
BspTI CTTAAG 1 cut(s) 220
BsrI ACTGG 2 cut(s) 188, 316
BssECI CCNNGG 1 cut(s) 258
BssMI GATC 2 cut(s) 73, 361
Bst4CI ACNGT 1 cut(s) 430
Bst6I CTCTTC 1 cut(s) 46
BstAFI CTTAAG 1 cut(s) 220
BstBI TTCGAA 2 cut(s) 200, 377
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 3 cut(s) 228, 366, 465
BstENI CCTNNNNNAGG 2 cut(s) 257, 527
BstF5I GGATG 3 cut(s) 271, 290, 307
BstFNI CGCG 2 cut(s) 48, 169
BstHHI GCGC 2 cut(s) 48, 169
BstKTI GATC 2 cut(s) 76, 364
BstMAI GTCTC 1 cut(s) 174
BstMBI GATC 2 cut(s) 73, 361
BstMWI GCNNNNNNNGC 2 cut(s) 222, 352
BstNSI RCATGY 1 cut(s) 417
BstSFI CTRYAG 1 cut(s) 429
BstUI CGCG 2 cut(s) 48, 169
BstV1I GCAGC 2 cut(s) 324, 364
BstV2I GAAGAC 1 cut(s) 459
BsuI GTATCC 1 cut(s) 134
BsuRI GGCC 1 cut(s) 153
BtsCI GGATG 3 cut(s) 271, 290, 307
BtsIMutI CAGTG 2 cut(s) 168, 323
Cac8I GCNNGC 1 cut(s) 171
CfoI GCGC 2 cut(s) 48, 169
Cfr13I GGNCC 1 cut(s) 520
Csp6I GTAC 1 cut(s) 383
CviAII CATG 2 cut(s) 349, 414
CviJI RGCY 9 cut(s) 32, 118, 153, 225, 232, 294, 315, 346, 509
CviKI_1 RGCY 9 cut(s) 32, 118, 153, 225, 232, 294, 315, 346, 509
CviQI GTAC 1 cut(s) 383
DdeI CTNAG 3 cut(s) 228, 366, 465
DpnI GATC 2 cut(s) 75, 363
DpnII GATC 2 cut(s) 73, 361
EaeI YGGCCR 1 cut(s) 151
Eam1104I CTCTTC 1 cut(s) 46
EarI CTCTTC 1 cut(s) 46
Ecl136II GAGCTC 1 cut(s) 346
Eco24I GRGCYC 1 cut(s) 348
Eco47I GGWCC 1 cut(s) 520
Eco53kI GAGCTC 1 cut(s) 346
Eco57I CTGAAG 1 cut(s) 531
EcoICRI GAGCTC 1 cut(s) 346
EcoNI CCTNNNNNAGG 2 cut(s) 257, 527
EcoRI GAATTC 1 cut(s) 269
EcoT38I GRGCYC 1 cut(s) 348
FaeI CATG 2 cut(s) 352, 417
FaiI YATR 5 cut(s) 135, 189, 350, 357, 415
FalI AAGNNNNNCTT 1 cut(s) 521
FatI CATG 2 cut(s) 348, 413
Fnu4HI GCNGC 3 cut(s) 313, 353, 544
FokI GGATG 3 cut(s) 278, 297, 314
FriOI GRGCYC 1 cut(s) 348
Fsp4HI GCNGC 3 cut(s) 313, 353, 544
GlaI GCGC 2 cut(s) 47, 168
GluI GCNGC 3 cut(s) 313, 353, 544
GsaI CCCAGC 1 cut(s) 122
HaeIII GGCC 1 cut(s) 153
HhaI GCGC 2 cut(s) 48, 169
Hin1II CATG 2 cut(s) 352, 417
Hin6I GCGC 2 cut(s) 46, 167
HinP1I GCGC 2 cut(s) 46, 167
HinfI GANTC 1 cut(s) 108
HphI GGTGA 1 cut(s) 32
Hpy188I TCNGA 3 cut(s) 97, 229, 451
Hpy188III TCNNGA 4 cut(s) 112, 274, 365, 538
HpyAV CCTTC 2 cut(s) 506, 533
HpyCH4III ACNGT 1 cut(s) 430
HpyCH4V TGCA 2 cut(s) 90, 352
HpyF10VI GCNNNNNNNGC 2 cut(s) 222, 352
HpyF3I CTNAG 3 cut(s) 228, 366, 465
Hsp92II CATG 2 cut(s) 352, 417
HspAI GCGC 2 cut(s) 46, 167
Kzo9I GATC 2 cut(s) 73, 361
LguI GCTCTTC 1 cut(s) 46
LmnI GCTCC 2 cut(s) 343, 498
LpnPI CCDG 7 cut(s) 3, 104, 169, 246, 329, 378, 437
Lsp1109I GCAGC 2 cut(s) 324, 364
MaeIII GTNAC 2 cut(s) 325, 416
MalI GATC 2 cut(s) 75, 363
MboI GATC 2 cut(s) 73, 361
MboII GAAGA 2 cut(s) 63, 464
MfeI CAATTG 1 cut(s) 57
MhlI GDGCHC 2 cut(s) 175, 348
MlsI TGGCCA 1 cut(s) 153
MluCI AATT 5 cut(s) 57, 85, 246, 269, 474
MluNI TGGCCA 1 cut(s) 153
MmeI TCCRAC 3 cut(s) 219, 427, 498
Mox20I TGGCCA 1 cut(s) 153
MscI TGGCCA 1 cut(s) 153
MseI TTAA 2 cut(s) 104, 221
Msp20I TGGCCA 1 cut(s) 153
MspA1I CMGCKG 1 cut(s) 509
MspCI CTTAAG 1 cut(s) 220
MunI CAATTG 1 cut(s) 57
MvnI CGCG 2 cut(s) 48, 169
MwoI GCNNNNNNNGC 2 cut(s) 222, 352
NdeII GATC 2 cut(s) 73, 361
NlaIII CATG 2 cut(s) 352, 417
NmuCI GTSAC 2 cut(s) 325, 416
NspI RCATGY 1 cut(s) 417
NspV TTCGAA 2 cut(s) 200, 377
PciI ACATGT 1 cut(s) 413
PciSI GCTCTTC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 108
PkrI GCNGC 3 cut(s) 314, 354, 545
PscI ACATGT 1 cut(s) 413
Psp124BI GAGCTC 1 cut(s) 348
PspFI CCCAGC 1 cut(s) 118
PspPI GGNCC 1 cut(s) 520
PvuII CAGCTG 1 cut(s) 509
RsaI GTAC 1 cut(s) 384
RsaNI GTAC 1 cut(s) 383
SacI GAGCTC 1 cut(s) 348
SapI GCTCTTC 1 cut(s) 46
SaqAI TTAA 2 cut(s) 104, 221
SatI GCNGC 3 cut(s) 313, 353, 544
Sau3AI GATC 2 cut(s) 73, 361
Sau96I GGNCC 1 cut(s) 520
ScaI AGTACT 1 cut(s) 384
SduI GDGCHC 2 cut(s) 175, 348
SfcI CTRYAG 1 cut(s) 429
SfuI TTCGAA 2 cut(s) 200, 377
SinI GGWCC 1 cut(s) 520
SmlI CTYRAG 3 cut(s) 220, 527, 538
SmoI CTYRAG 3 cut(s) 220, 527, 538
Sse9I AATT 5 cut(s) 57, 85, 246, 269, 474
SsiI CCGC 1 cut(s) 48
SstI GAGCTC 1 cut(s) 348
TaaI ACNGT 1 cut(s) 430
TaqI TCGA 4 cut(s) 28, 111, 200, 377
TaqII GACCGA 1 cut(s) 485
TasI AATT 5 cut(s) 57, 85, 246, 269, 474
TatI WGTACW 1 cut(s) 382
TfiI GAWTC 1 cut(s) 108
Tru1I TTAA 2 cut(s) 104, 221
Tru9I TTAA 2 cut(s) 104, 221
TscAI CASTG 2 cut(s) 168, 323
TseFI GTSAC 2 cut(s) 325, 416
TseI GCWGC 3 cut(s) 312, 352, 543
Tsp45I GTSAC 2 cut(s) 325, 416
TspDTI ATGAA 1 cut(s) 282
TspRI CASTG 2 cut(s) 168, 323
Vha464I CTTAAG 1 cut(s) 220
VpaK11BI GGWCC 1 cut(s) 520
XagI CCTNNNNNAGG 2 cut(s) 257, 527
XapI RAATTY 2 cut(s) 269, 474
XceI RCATGY 1 cut(s) 417
ZrmI AGTACT 1 cut(s) 384
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.