Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8359501.1

Orthogroup ID

OG0016995

Physical Location & Seq

Genomic Coordinates Reverse (-)

670 .. 1068

Gene Structure 399 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8359501.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 399 bp

atgttggtacaagacacacataaccaagctggcattgctcataatggttgcatagtgcctctactcaagttacttaatttgataaatgaatctctgcaccacaatgctgcatttgctctatatggtcttgccgataaggaggataacattgcagcttttattaaatttggaattgttcagaaattgcaaaaggcagaattccttgttcaacaaactaaagattctgttgaaaagacattgaaaagattagaggggaagatttctggacgggttgttgacaaggctgttcaaagtcgagtagctatggtttttgctcgtctttttaagcctggtgattgtgattcattgaacacaaaggaatgcagctgctgttggggcttcttaagtctaaaagcctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005886 GO:0006950 GO:0006970 GO:0008150 GO:0009628 GO:0009651 GO:0009719 GO:0009725 GO:0009737 GO:0010029 GO:0010033 GO:0010187 GO:0016020 GO:0033993 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0048519 GO:0048580 GO:0048581 GO:0050789 GO:0050793 GO:0050896 GO:0051093 GO:0051239 GO:0051241 GO:0065007 GO:0071944 GO:0097305 GO:1900140 GO:1901700 GO:2000026

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Arm BTB

Protein Analysis

132

Amino Acids

14.59

Weight (kDa)

8.85

Isoelectric Point (pI)

29.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016995)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0488471 RchiOBHm_Chr5g0027461 RchiOBHm_Chr6g0244361 RchiOBHm_Chr7g0200771
rosa_multiflora	Rmu_co8359501.1_g000001 Rmu_sc0004533.1_g000001 Rmu_sc0006898.1_g000005 Rmu_sc0032734.1_g000002
rosa_roxburghii	Rroxscaffold_1G00027710 Rroxscaffold_1G00074240
rosa_samantha	Rh5BG270700 Rh6AG023200 Rh7CG467100
rosa_wichuraiana	Rw3G025410

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	164, 197
AfaI	GTAC	1 cut(s)	9
AflII	CTTAAG	1 cut(s)	382
AgsI	TTSAA	5 cut(s)	209, 230, 241, 290, 349
AjnI	CCWGG	1 cut(s)	328
AluBI	AGCT	4 cut(s)	29, 155, 302, 366
AluI	AGCT	4 cut(s)	29, 155, 302, 366
AlwNI	CAGNNNCTG	1 cut(s)	369
ApeKI	GCWGC	4 cut(s)	107, 152, 363, 366
ApoI	RAATTY	2 cut(s)	164, 197
AsuHPI	GGTGA	1 cut(s)	344
BbvI	GCAGC	4 cut(s)	94, 164, 353, 375
BciT130I	CCWGG	1 cut(s)	330
BfrI	CTTAAG	1 cut(s)	382
BisI	GCNGC	4 cut(s)	108, 153, 364, 367
BlsI	GCNGC	4 cut(s)	109, 154, 365, 368
Bme1390I	CCNGG	1 cut(s)	330
BmrFI	CCNGG	1 cut(s)	330
BpuEI	CTTGAG	1 cut(s)	50
Bse3DI	GCAATG	2 cut(s)	33, 147
BseBI	CCWGG	1 cut(s)	330
BseMI	GCAATG	2 cut(s)	33, 147
BseXI	GCAGC	4 cut(s)	94, 164, 353, 375
BsgI	GTGCAG	1 cut(s)	80
BsmI	GAATGC	1 cut(s)	365
BspTI	CTTAAG	1 cut(s)	382
BsrDI	GCAATG	2 cut(s)	33, 147
Bst2UI	CCWGG	1 cut(s)	330
BstAFI	CTTAAG	1 cut(s)	382
BstC8I	GCNNGC	1 cut(s)	31
BstMWI	GCNNNNNNNGC	3 cut(s)	35, 113, 375
BstNI	CCWGG	1 cut(s)	330
BstSCI	CCNGG	1 cut(s)	328
BstV1I	GCAGC	4 cut(s)	94, 164, 353, 375
Cac8I	GCNNGC	1 cut(s)	31
CaiI	CAGNNNCTG	1 cut(s)	369
Csp6I	GTAC	1 cut(s)	8
CviJI	RGCY	8 cut(s)	29, 155, 284, 302, 328, 366, 378, 395
CviKI_1	RGCY	8 cut(s)	29, 155, 284, 302, 328, 366, 378, 395
CviQI	GTAC	1 cut(s)	8
EcoRI	GAATTC	1 cut(s)	197
EcoRII	CCWGG	1 cut(s)	328
FaiI	YATR	6 cut(s)	21, 42, 53, 121, 123, 305
Fnu4HI	GCNGC	4 cut(s)	108, 153, 364, 367
Fsp4HI	GCNGC	4 cut(s)	108, 153, 364, 367
GluI	GCNGC	4 cut(s)	108, 153, 364, 367
HincII	GTYRAC	1 cut(s)	277
HindII	GTYRAC	1 cut(s)	277
HinfI	GANTC	3 cut(s)	89, 221, 341
HphI	GGTGA	1 cut(s)	344
Hpy166II	GTNNAC	1 cut(s)	277
Hpy188I	TCNGA	1 cut(s)	180
Hpy188III	TCNNGA	1 cut(s)	264
Hpy8I	GTNNAC	1 cut(s)	277
HpyCH4V	TGCA	6 cut(s)	51, 97, 110, 152, 187, 363
HpyF10VI	GCNNNNNNNGC	3 cut(s)	35, 113, 375
LpnPI	CCDG	4 cut(s)	15, 249, 315, 342
Lsp1109I	GCAGC	4 cut(s)	94, 164, 353, 375
MaeIII	GTNAC	1 cut(s)	69
MboII	GAAGA	1 cut(s)	268
MluCI	AATT	5 cut(s)	76, 164, 171, 182, 197
MnlI	CCTC	3 cut(s)	69, 133, 244
MseI	TTAA	4 cut(s)	75, 162, 324, 383
MslI	CAYNNNNRTG	1 cut(s)	102
MspA1I	CMGCKG	1 cut(s)	366
MspCI	CTTAAG	1 cut(s)	382
MspR9I	CCNGG	1 cut(s)	330
Mva1269I	GAATGC	1 cut(s)	365
MvaI	CCWGG	1 cut(s)	330
MwoI	GCNNNNNNNGC	3 cut(s)	35, 113, 375
PctI	GAATGC	1 cut(s)	365
PfeI	GAWTC	3 cut(s)	89, 221, 341
PkrI	GCNGC	4 cut(s)	109, 154, 365, 368
Psp6I	CCWGG	1 cut(s)	328
PspGI	CCWGG	1 cut(s)	328
PstNI	CAGNNNCTG	1 cut(s)	369
PvuII	CAGCTG	1 cut(s)	366
RsaI	GTAC	1 cut(s)	9
RsaNI	GTAC	1 cut(s)	8
RseI	CAYNNNNRTG	1 cut(s)	102
SaqAI	TTAA	4 cut(s)	75, 162, 324, 383
SatI	GCNGC	4 cut(s)	108, 153, 364, 367
ScrFI	CCNGG	1 cut(s)	330
SetI	ASST	4 cut(s)	31, 157, 304, 368
SmiMI	CAYNNNNRTG	1 cut(s)	102
SmlI	CTYRAG	2 cut(s)	65, 382
SmoI	CTYRAG	2 cut(s)	65, 382
Sse9I	AATT	5 cut(s)	76, 164, 171, 182, 197
StyD4I	CCNGG	1 cut(s)	328
TaqI	TCGA	1 cut(s)	295
TasI	AATT	5 cut(s)	76, 164, 171, 182, 197
TfiI	GAWTC	3 cut(s)	89, 221, 341
Tru1I	TTAA	4 cut(s)	75, 162, 324, 383
Tru9I	TTAA	4 cut(s)	75, 162, 324, 383
TseI	GCWGC	4 cut(s)	107, 152, 363, 366
TspDTI	ATGAA	2 cut(s)	102, 333
Vha464I	CTTAAG	1 cut(s)	382
XapI	RAATTY	2 cut(s)	164, 197

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.