Rroxscaffold_1G00074240

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
95230607 .. 95234985
4379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00074240.1

Sequence Viewer

Length: 273 bp
ATGGACGGTATAAGTGTTAATTTTGAAGGCTGGACTGATGAAGAAGATGCAGAGGAAGAAGACGGAGTAAGGCAAAGAATGGGATTAAGAAACCAGAATGCTGCAAAAAAATCTAGGTCCAGAATGCTATTTGGAAAGGAAAATGTCAAGTATTTCAATGGAGCCATCTCAGTCTTAAGAATCTCTCTGCTTGCTCCTATCTTTGCCTGCAAGATCAATCCTTCAATATGTGTGGTCAGCAAATTCACTTTGCACAACTTTGAAGTCATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.18

Weight (kDa)

6.57

Isoelectric Point (pI)

42.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 242
AflII CTTAAG 1 cut(s) 175
AgsI TTSAA 4 cut(s) 26, 157, 225, 263
ApeKI GCWGC 1 cut(s) 101
ApoI RAATTY 1 cut(s) 242
AspS9I GGNCC 1 cut(s) 117
AvaII GGWCC 1 cut(s) 117
BbsI GAAGAC 1 cut(s) 66
BbvI GCAGC 1 cut(s) 88
BccI CCATC 1 cut(s) 173
BfaI CTAG 2 cut(s) 114, 271
BfrI CTTAAG 1 cut(s) 175
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme18I GGWCC 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 163
BmsI GCATC 1 cut(s) 37
BpiI GAAGAC 1 cut(s) 66
BseMII CTCAG 1 cut(s) 183
BseXI GCAGC 1 cut(s) 88
BsmI GAATGC 2 cut(s) 103, 129
Bsp143I GATC 1 cut(s) 213
BspCNI CTCAG 1 cut(s) 182
BspLI GGNNCC 1 cut(s) 163
BspTI CTTAAG 1 cut(s) 175
BssMI GATC 1 cut(s) 213
Bst4CI ACNGT 1 cut(s) 8
BstAFI CTTAAG 1 cut(s) 175
BstC8I GCNNGC 2 cut(s) 192, 208
BstDEI CTNAG 1 cut(s) 169
BstKTI GATC 1 cut(s) 216
BstMBI GATC 1 cut(s) 213
BstV1I GCAGC 1 cut(s) 88
BstV2I GAAGAC 1 cut(s) 66
Cac8I GCNNGC 2 cut(s) 192, 208
Cfr13I GGNCC 1 cut(s) 117
CspCI CAANNNNNGTGG 2 cut(s) 213, 248
CviJI RGCY 2 cut(s) 30, 164
CviKI_1 RGCY 2 cut(s) 30, 164
DdeI CTNAG 1 cut(s) 169
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
Eco47I GGWCC 1 cut(s) 117
FaiI YATR 2 cut(s) 11, 229
Fnu4HI GCNGC 1 cut(s) 102
Fsp4HI GCNGC 1 cut(s) 102
FspBI CTAG 2 cut(s) 114, 271
GluI GCNGC 1 cut(s) 102
HinfI GANTC 1 cut(s) 180
Hpy188III TCNNGA 1 cut(s) 120
HpyAV CCTTC 2 cut(s) 20, 231
HpyCH4III ACNGT 1 cut(s) 8
HpyCH4V TGCA 4 cut(s) 50, 104, 210, 253
HpyF3I CTNAG 1 cut(s) 169
Kzo9I GATC 1 cut(s) 213
LmnI GCTCC 2 cut(s) 161, 199
LpnPI CCDG 4 cut(s) 16, 107, 133, 220
Lsp1109I GCAGC 1 cut(s) 88
LweI GCATC 1 cut(s) 37
MaeI CTAG 2 cut(s) 114, 271
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MboII GAAGA 4 cut(s) 53, 56, 68, 71
MluCI AATT 2 cut(s) 19, 242
MnlI CCTC 1 cut(s) 46
MseI TTAA 3 cut(s) 18, 86, 176
MspCI CTTAAG 1 cut(s) 175
Mva1269I GAATGC 2 cut(s) 103, 129
NdeII GATC 1 cut(s) 213
NlaIV GGNNCC 1 cut(s) 163
PctI GAATGC 2 cut(s) 103, 129
PfeI GAWTC 1 cut(s) 180
PkrI GCNGC 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 163
PspPI GGNCC 1 cut(s) 117
SaqAI TTAA 3 cut(s) 18, 86, 176
SatI GCNGC 1 cut(s) 102
Sau3AI GATC 1 cut(s) 213
Sau96I GGNCC 1 cut(s) 117
SetI ASST 1 cut(s) 119
SfaNI GCATC 1 cut(s) 37
SgeI CNNG 8 cut(s) 43, 106, 126, 132, 160, 203, 219, 223
SinI GGWCC 1 cut(s) 117
SmlI CTYRAG 1 cut(s) 175
SmoI CTYRAG 1 cut(s) 175
Sse9I AATT 2 cut(s) 19, 242
SspMI CTAG 2 cut(s) 114, 271
TaaI ACNGT 1 cut(s) 8
TasI AATT 2 cut(s) 19, 242
TfiI GAWTC 1 cut(s) 180
Tru1I TTAA 3 cut(s) 18, 86, 176
Tru9I TTAA 3 cut(s) 18, 86, 176
TseI GCWGC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 54
TspGWI ACGGA 1 cut(s) 78
Vha464I CTTAAG 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 117
XapI RAATTY 1 cut(s) 242
XspI CTAG 2 cut(s) 114, 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.