Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8360925.1

Orthogroup ID

OG0011561

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1017

Gene Structure 1017 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8360925.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 754 bp

atgccatcttcactaggttaccagtcaactgcaacagaccaagaatccgtgatgtttgtccatacagtttcagaggcacgtcgtatgcttccttcagcaagtcgctggaactctatagaaattgacttcaatcttgttcctcaatctggcatcgcctatgattcactgccttctagttactccaagtcctatgattacgatattgttattagagatagaaagatcttcaaacgttgtctttacatttctgcctcaatagttagtcttattgtagctctaattttgctactacggtttttgcctcacaagcatcatcaccatggtccttcaaagaatctgacacttgcattgaaccaagctctaaccttcttcgatgctcaaaaatctgggacttaccccaaaaatagtccagtaaaatttcgaggggattcaggattgcaagatgggaatttgaccagtaaccacgcaaatcttgtgggcggtttctatgattctggaaacaacatgaagttcagtttctctacagcttataccatgaccttgttaagttggactgtgattgaataccaccaaaaatatgctgatatcagtgagcttgaccatgtcaaggatataatcaaatggggcagtgattatttgctcaaagtcttcgttcctccaaatgcaacttcagataccacattgtattctcaggcaagccttatgattcatgaacatcaattttgtatcacaatcttttctcgtgaatacgata

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00500 ko01100 map00500 map01100

Pfam Domains

Protein Families

Glyco_hydro_9

Protein Analysis

251

Amino Acids

28.44

Weight (kDa)

6.83

Isoelectric Point (pI)

51.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011561)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g11730 FvH4_5g11730 FvH4_5g11730 FvH4_5g11730 FvH4_5g11730
malus_domestica	MD14G1229100.v1.1
prunus_persica	Prupe.5G224000_v2.0.a1
pyrus_communis	pycom14g19020
rosa_chinensis	RchiOBHm_Chr7g0186031
rosa_laevigata	RLG00000004871
rosa_multiflora	Rmu_co8323287.1_g000001 Rmu_co8360925.1_g000001 Rmu_sc0000194.1_g000020
rosa_roxburghii	Rroxscaffold_3G00268490
rosa_rugosa	Rorug06G0471800
rosa_samantha	Rh7AG070200 Rh7BG086200 Rh7CG078100 Rh7DG078100
rosa_wichuraiana	Rw7G006490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	480
AclI	AACGTT	1 cut(s)	232
AcsI	RAATTY	2 cut(s)	416, 448
AcuI	CTGAAG	2 cut(s)	78, 654
AfiI	CCNNNNNNNGG	2 cut(s)	146, 607
AgsI	TTSAA	5 cut(s)	130, 229, 330, 352, 563
AjiI	CACGTC	1 cut(s)	80
AjuI	GAANNNNNNNTTGG	2 cut(s)	652, 684
AluBI	AGCT	4 cut(s)	275, 359, 527, 595
AluI	AGCT	4 cut(s)	275, 359, 527, 595
ApoI	RAATTY	2 cut(s)	416, 448
AspS9I	GGNCC	1 cut(s)	323
AsuHPI	GGTGA	1 cut(s)	308
AvaII	GGWCC	1 cut(s)	323
BarI	GAAGNNNNNNTAC	2 cut(s)	76, 108
BauI	CACGAG	1 cut(s)	741
BbsI	GAAGAC	1 cut(s)	640
BccI	CCATC	2 cut(s)	13, 437
BfaI	CTAG	2 cut(s)	14, 174
BfmI	CTRYAG	2 cut(s)	114, 522
BglII	AGATCT	1 cut(s)	222
Bme18I	GGWCC	1 cut(s)	323
BmgBI	CACGTC	1 cut(s)	80
BmgT120I	GGNCC	1 cut(s)	323
BmsI	GCATC	3 cut(s)	159, 319, 364
BpiI	GAAGAC	1 cut(s)	640
BsaJI	CCNNGG	1 cut(s)	319
Bsc4I	CCNNNNNNNGG	2 cut(s)	146, 607
Bse1I	ACTGG	3 cut(s)	22, 410, 456
BseDI	CCNNGG	1 cut(s)	319
BseLI	CCNNNNNNNGG	2 cut(s)	146, 607
BseMII	CTCAG	1 cut(s)	704
BseNI	ACTGG	3 cut(s)	22, 410, 456
BslFI	GGGAC	1 cut(s)	403
BslI	CCNNNNNNNGG	2 cut(s)	146, 607
BsmFI	GGGAC	1 cut(s)	403
Bsp143I	GATC	1 cut(s)	222
Bsp19I	CCATGG	1 cut(s)	319
BspACI	CCGC	1 cut(s)	480
BspCNI	CTCAG	1 cut(s)	703
BspHI	TCATGA	1 cut(s)	709
BsrI	ACTGG	3 cut(s)	22, 410, 456
BssECI	CCNNGG	1 cut(s)	319
BssMI	GATC	1 cut(s)	222
BssSI	CACGAG	1 cut(s)	741
BssT1I	CCWWGG	1 cut(s)	319
Bst2BI	CACGAG	1 cut(s)	741
Bst4CI	ACNGT	3 cut(s)	67, 294, 556
BstC8I	GCNNGC	1 cut(s)	697
BstDEI	CTNAG	1 cut(s)	690
BstDSI	CCRYGG	1 cut(s)	319
BstEII	GGTNACC	1 cut(s)	17
BstKTI	GATC	1 cut(s)	225
BstMBI	GATC	1 cut(s)	222
BstMWI	GCNNNNNNNGC	1 cut(s)	307
BstPI	GGTNACC	1 cut(s)	17
BstSFI	CTRYAG	2 cut(s)	114, 522
BstV2I	GAAGAC	1 cut(s)	640
BstX2I	RGATCY	1 cut(s)	222
BstYI	RGATCY	1 cut(s)	222
BtgI	CCRYGG	1 cut(s)	319
BtgZI	GCGATG	1 cut(s)	136
BtrI	CACGTC	1 cut(s)	80
BtsI	GCAGTG	2 cut(s)	164, 634
BtsIMutI	CAGTG	3 cut(s)	164, 595, 634
Cac8I	GCNNGC	1 cut(s)	697
CciI	TCATGA	1 cut(s)	709
Cfr13I	GGNCC	1 cut(s)	323
CspCI	CAANNNNNGTGG	2 cut(s)	456, 491
CviAII	CATG	5 cut(s)	320, 505, 535, 602, 710
CviJI	RGCY	5 cut(s)	275, 359, 527, 595, 699
CviKI_1	RGCY	5 cut(s)	275, 359, 527, 595, 699
DdeI	CTNAG	1 cut(s)	690
DpnI	GATC	1 cut(s)	224
DpnII	GATC	1 cut(s)	222
Eco130I	CCWWGG	1 cut(s)	319
Eco32I	GATATC	1 cut(s)	586
Eco47I	GGWCC	1 cut(s)	323
Eco57I	CTGAAG	2 cut(s)	78, 654
Eco91I	GGTNACC	1 cut(s)	17
EcoO65I	GGTNACC	1 cut(s)	17
EcoRV	GATATC	1 cut(s)	586
EcoT14I	CCWWGG	1 cut(s)	319
ErhI	CCWWGG	1 cut(s)	319
FaeI	CATG	5 cut(s)	323, 508, 538, 605, 713
FaqI	GGGAC	1 cut(s)	403
FatI	CATG	5 cut(s)	319, 504, 534, 601, 709
FspBI	CTAG	2 cut(s)	14, 174
Hin1II	CATG	5 cut(s)	323, 508, 538, 605, 713
HincII	GTYRAC	1 cut(s)	27
HindII	GTYRAC	1 cut(s)	27
HinfI	GANTC	6 cut(s)	44, 161, 334, 428, 491, 706
HphI	GGTGA	1 cut(s)	308
Hpy166II	GTNNAC	1 cut(s)	27
Hpy188I	TCNGA	3 cut(s)	73, 339, 673
Hpy188III	TCNNGA	4 cut(s)	432, 495, 710, 743
Hpy8I	GTNNAC	1 cut(s)	27
Hpy99I	CGWCG	1 cut(s)	84
HpyAV	CCTTC	4 cut(s)	102, 180, 336, 376
HpyCH4III	ACNGT	3 cut(s)	67, 294, 556
HpyCH4IV	ACGT	2 cut(s)	79, 232
HpyCH4V	TGCA	4 cut(s)	32, 347, 439, 665
HpyF10VI	GCNNNNNNNGC	1 cut(s)	307
HpyF3I	CTNAG	1 cut(s)	690
HpySE526I	ACGT	2 cut(s)	79, 232
Hsp92II	CATG	5 cut(s)	323, 508, 538, 605, 713
Kzo9I	GATC	1 cut(s)	222
LpnPI	CCDG	9 cut(s)	35, 91, 132, 372, 417, 423, 469, 480, 677
LweI	GCATC	3 cut(s)	159, 319, 364
MaeI	CTAG	2 cut(s)	14, 174
MaeII	ACGT	2 cut(s)	79, 232
MaeIII	GTNAC	3 cut(s)	17, 176, 458
MalI	GATC	1 cut(s)	224
MboI	GATC	1 cut(s)	222
MboII	GAAGA	3 cut(s)	217, 361, 640
MflI	RGATCY	1 cut(s)	222
MluCI	AATT	5 cut(s)	120, 279, 416, 448, 719
MmeI	TCCRAC	1 cut(s)	530
MnlI	CCTC	6 cut(s)	67, 150, 262, 312, 416, 666
MseI	TTAA	1 cut(s)	545
MslI	CAYNNNNRTG	1 cut(s)	318
MwoI	GCNNNNNNNGC	1 cut(s)	307
NcoI	CCATGG	1 cut(s)	319
NdeII	GATC	1 cut(s)	222
NlaIII	CATG	5 cut(s)	323, 508, 538, 605, 713
PagI	TCATGA	1 cut(s)	709
PfeI	GAWTC	6 cut(s)	44, 161, 334, 428, 491, 706
PflFI	GACNNNGTC	1 cut(s)	602
Psp1406I	AACGTT	1 cut(s)	232
PspEI	GGTNACC	1 cut(s)	17
PspPI	GGNCC	1 cut(s)	323
PsuI	RGATCY	1 cut(s)	222
PsyI	GACNNNGTC	1 cut(s)	602
RseI	CAYNNNNRTG	1 cut(s)	318
SaqAI	TTAA	1 cut(s)	545
Sau3AI	GATC	1 cut(s)	222
Sau96I	GGNCC	1 cut(s)	323
SetI	ASST	9 cut(s)	19, 82, 235, 277, 361, 368, 529, 542, 597
SfaNI	GCATC	3 cut(s)	159, 319, 364
SfcI	CTRYAG	2 cut(s)	114, 522
SinI	GGWCC	1 cut(s)	323
SmiMI	CAYNNNNRTG	1 cut(s)	318
Sse9I	AATT	5 cut(s)	120, 279, 416, 448, 719
SsiI	CCGC	1 cut(s)	480
SspMI	CTAG	2 cut(s)	14, 174
StyI	CCWWGG	1 cut(s)	319
TaaI	ACNGT	3 cut(s)	67, 294, 556
TaiI	ACGT	2 cut(s)	82, 235
TaqI	TCGA	2 cut(s)	372, 421
TasI	AATT	5 cut(s)	120, 279, 416, 448, 719
TfiI	GAWTC	6 cut(s)	44, 161, 334, 428, 491, 706
Tru1I	TTAA	1 cut(s)	545
Tru9I	TTAA	1 cut(s)	545
TscAI	CASTG	3 cut(s)	171, 595, 634
TspDTI	ATGAA	3 cut(s)	521, 698, 726
TspGWI	ACGGA	1 cut(s)	37
TspRI	CASTG	3 cut(s)	171, 595, 634
Tth111I	GACNNNGTC	1 cut(s)	602
VpaK11BI	GGWCC	1 cut(s)	323
XapI	RAATTY	2 cut(s)	416, 448
XspI	CTAG	2 cut(s)	14, 174

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.