Rmu_co8372769.1_g000001

Plasma membrane ATPase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8372769.1
OG0006441
Physical Location & Seq
Reverse (-)
2 .. 1086
1085 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8372769.1_g000001.1.cds

Sequence Viewer

Length: 589 bp
atgtatccatcttctgcattgctcggccaagacaaggatgcgtccatttctgccctccccattgacgaattgattgagaaggctgatggatttgctggagtatttccagagcacaaatatgaaattgtaaggaggctgcaagagaggaagcacatctgtggaatgactggagatggtgtcaacgatgctcctgctttgaaaaaagcagacattggaattgctgtagctgatgctactgatgctgctagaggtgcttcagatattgttctgactgaacctggattaagtgtgataataagcgcagtacttacaagccgggccatatttcagaggatgaagaactatactatctacgccgtttcaattaccatacgtatagtgtttggctttatgctcatcgctttgatatggcagtttgactttgcacccttcatggtattgatcattgctatactaaatgatggaacgatcatgacaatatccaaggaccgagtgaaaccatctccaatgccagacagctggaaactgaaagaaatttttgctactggcattgttcttggaggttacatggccttgatgacagtagtgt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

196

Amino Acids

21.32

Weight (kDa)

5.68

Isoelectric Point (pI)

38.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 25
AcsI RAATTY 1 cut(s) 534
AcuI CTGAAG 1 cut(s) 240
AfaI GTAC 1 cut(s) 306
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 2 cut(s) 199, 363
AjnI CCWGG 1 cut(s) 277
AleI CACNNNNGTG 1 cut(s) 156
AluBI AGCT 2 cut(s) 227, 519
AluI AGCT 2 cut(s) 227, 519
Alw21I GWGCWC 1 cut(s) 114
AoxI GGCC 3 cut(s) 25, 318, 570
ApeKI GCWGC 2 cut(s) 136, 242
ApoI RAATTY 1 cut(s) 534
AspLEI GCGC 1 cut(s) 302
AspS9I GGNCC 2 cut(s) 318, 487
AsuC2I CCSGG 1 cut(s) 317
AvaII GGWCC 1 cut(s) 487
Bbv12I GWGCWC 1 cut(s) 114
BbvI GCAGC 2 cut(s) 123, 229
BccI CCATC 5 cut(s) 16, 80, 167, 455, 508
BceAI ACGGC 1 cut(s) 341
BcgI CGANNNNNNTGC 2 cut(s) 173, 207
BciT130I CCWGG 1 cut(s) 279
BciVI GTATCC 1 cut(s) 15
BclI TGATCA 1 cut(s) 441
BcnI CCSGG 1 cut(s) 317
BfaI CTAG 1 cut(s) 246
BfmI CTRYAG 1 cut(s) 222
BfuI GTATCC 1 cut(s) 15
BisI GCNGC 2 cut(s) 137, 243
BlsI GCNGC 2 cut(s) 138, 244
BmcAI AGTACT 1 cut(s) 306
Bme1390I CCNGG 2 cut(s) 279, 317
Bme18I GGWCC 1 cut(s) 487
BmgT120I GGNCC 2 cut(s) 318, 487
BmrFI CCNGG 2 cut(s) 279, 317
BmsI GCATC 4 cut(s) 28, 175, 220, 229
BpmI CTGGAG 2 cut(s) 117, 189
BpuMI CCSGG 1 cut(s) 317
BsaAI YACGTR 1 cut(s) 374
BsaJI CCNNGG 1 cut(s) 483
BsaXI ACNNNNNCTCC 2 cut(s) 162, 192
Bsc4I CCNNNNNNNGG 1 cut(s) 34
Bse1I ACTGG 2 cut(s) 172, 550
Bse3DI GCAATG 2 cut(s) 17, 444
BseBI CCWGG 1 cut(s) 279
BseDI CCNNGG 1 cut(s) 483
BseGI GGATG 2 cut(s) 43, 339
BseLI CCNNNNNNNGG 1 cut(s) 34
BseMI GCAATG 2 cut(s) 17, 444
BseNI ACTGG 2 cut(s) 172, 550
BseXI GCAGC 2 cut(s) 123, 229
BshFI GGCC 3 cut(s) 27, 320, 572
BsiHKAI GWGCWC 1 cut(s) 114
BsiSI CCGG 1 cut(s) 316
BslI CCNNNNNNNGG 1 cut(s) 34
BsnI GGCC 3 cut(s) 27, 320, 572
Bsp1286I GDGCHC 1 cut(s) 114
Bsp143I GATC 2 cut(s) 441, 468
BspANI GGCC 3 cut(s) 27, 320, 572
BspHI TCATGA 1 cut(s) 471
BsrDI GCAATG 2 cut(s) 17, 444
BsrI ACTGG 2 cut(s) 172, 550
BssECI CCNNGG 1 cut(s) 483
BssMI GATC 2 cut(s) 441, 468
BssT1I CCWWGG 1 cut(s) 483
Bst2UI CCWGG 1 cut(s) 279
Bst4CI ACNGT 1 cut(s) 583
BstBAI YACGTR 1 cut(s) 374
BstF5I GGATG 2 cut(s) 43, 339
BstHHI GCGC 1 cut(s) 302
BstKTI GATC 2 cut(s) 444, 471
BstMBI GATC 2 cut(s) 441, 468
BstMWI GCNNNNNNNGC 2 cut(s) 239, 251
BstNI CCWGG 1 cut(s) 279
BstSCI CCNGG 2 cut(s) 277, 315
BstSFI CTRYAG 1 cut(s) 222
BstSNI TACGTA 1 cut(s) 374
BstV1I GCAGC 2 cut(s) 123, 229
BstXI CCANNNNNNTGG 1 cut(s) 519
BsuI GTATCC 1 cut(s) 15
BsuRI GGCC 3 cut(s) 27, 320, 572
BtgZI GCGATG 1 cut(s) 382
BtsCI GGATG 2 cut(s) 43, 339
CciI TCATGA 1 cut(s) 471
CfoI GCGC 1 cut(s) 302
Cfr13I GGNCC 2 cut(s) 318, 487
CseI GACGC 1 cut(s) 30
Csp6I GTAC 1 cut(s) 305
CviAII CATG 3 cut(s) 433, 472, 568
CviJI RGCY 9 cut(s) 27, 83, 136, 227, 315, 320, 387, 519, 572
CviKI_1 RGCY 9 cut(s) 27, 83, 136, 227, 315, 320, 387, 519, 572
CviQI GTAC 1 cut(s) 305
DpnI GATC 2 cut(s) 443, 470
DpnII GATC 2 cut(s) 441, 468
EaeI YGGCCR 1 cut(s) 25
Eco105I TACGTA 1 cut(s) 374
Eco130I CCWWGG 1 cut(s) 483
Eco47I GGWCC 1 cut(s) 487
Eco57I CTGAAG 1 cut(s) 240
EcoRII CCWGG 1 cut(s) 277
EcoT14I CCWWGG 1 cut(s) 483
ErhI CCWWGG 1 cut(s) 483
FaeI CATG 3 cut(s) 436, 475, 571
FatI CATG 3 cut(s) 432, 471, 567
FbaI TGATCA 1 cut(s) 441
Fnu4HI GCNGC 2 cut(s) 137, 243
FokI GGATG 2 cut(s) 50, 346
Fsp4HI GCNGC 2 cut(s) 137, 243
FspBI CTAG 1 cut(s) 246
GlaI GCGC 1 cut(s) 301
GluI GCNGC 2 cut(s) 137, 243
GsuI CTGGAG 2 cut(s) 117, 189
HaeIII GGCC 3 cut(s) 27, 320, 572
HapII CCGG 1 cut(s) 316
HgaI GACGC 1 cut(s) 30
HhaI GCGC 1 cut(s) 302
Hin1II CATG 3 cut(s) 436, 475, 571
Hin6I GCGC 1 cut(s) 300
HinP1I GCGC 1 cut(s) 300
HincII GTYRAC 1 cut(s) 181
HindII GTYRAC 1 cut(s) 181
HpaII CCGG 1 cut(s) 316
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 3 cut(s) 259, 270, 330
Hpy188III TCNNGA 2 cut(s) 107, 472
Hpy8I GTNNAC 1 cut(s) 181
HpyAV CCTTC 2 cut(s) 73, 439
HpyCH4III ACNGT 1 cut(s) 583
HpyCH4IV ACGT 1 cut(s) 373
HpyCH4V TGCA 3 cut(s) 17, 139, 425
HpyF10VI GCNNNNNNNGC 2 cut(s) 239, 251
HpySE526I ACGT 1 cut(s) 373
Hsp92II CATG 3 cut(s) 436, 475, 571
HspAI GCGC 1 cut(s) 300
Ksp22I TGATCA 1 cut(s) 441
Kzo9I GATC 2 cut(s) 441, 468
LmnI GCTCC 1 cut(s) 193
Lsp1109I GCAGC 2 cut(s) 123, 229
LweI GCATC 4 cut(s) 28, 175, 220, 229
MaeI CTAG 1 cut(s) 246
MaeII ACGT 1 cut(s) 373
MaeIII GTNAC 1 cut(s) 563
MalI GATC 2 cut(s) 443, 470
MboI GATC 2 cut(s) 441, 468
MboII GAAGA 2 cut(s) 3, 349
MhlI GDGCHC 1 cut(s) 114
MluCI AATT 5 cut(s) 68, 123, 216, 363, 534
MnlI CCTC 6 cut(s) 65, 126, 138, 242, 324, 554
MseI TTAA 1 cut(s) 284
MslI CAYNNNNRTG 2 cut(s) 117, 156
MspA1I CMGCKG 1 cut(s) 519
MspI CCGG 1 cut(s) 316
MspR9I CCNGG 2 cut(s) 279, 317
MvaI CCWGG 1 cut(s) 279
MwoI GCNNNNNNNGC 2 cut(s) 239, 251
NciI CCSGG 1 cut(s) 317
NdeII GATC 2 cut(s) 441, 468
NlaIII CATG 3 cut(s) 436, 475, 571
OliI CACNNNNGTG 1 cut(s) 156
PagI TCATGA 1 cut(s) 471
PkrI GCNGC 2 cut(s) 138, 244
Ppu21I YACGTR 1 cut(s) 374
Psp6I CCWGG 1 cut(s) 277
PspGI CCWGG 1 cut(s) 277
PspPI GGNCC 2 cut(s) 318, 487
PvuII CAGCTG 1 cut(s) 519
RsaI GTAC 1 cut(s) 306
RsaNI GTAC 1 cut(s) 305
RseI CAYNNNNRTG 2 cut(s) 117, 156
SaqAI TTAA 1 cut(s) 284
SatI GCNGC 2 cut(s) 137, 243
Sau3AI GATC 2 cut(s) 441, 468
Sau96I GGNCC 2 cut(s) 318, 487
ScaI AGTACT 1 cut(s) 306
ScrFI CCNGG 2 cut(s) 279, 317
SduI GDGCHC 1 cut(s) 114
SetI ASST 6 cut(s) 229, 253, 280, 376, 521, 565
SfaNI GCATC 4 cut(s) 28, 175, 220, 229
SfcI CTRYAG 1 cut(s) 222
SinI GGWCC 1 cut(s) 487
SmiMI CAYNNNNRTG 2 cut(s) 117, 156
SnaBI TACGTA 1 cut(s) 374
Sse9I AATT 5 cut(s) 68, 123, 216, 363, 534
SspMI CTAG 1 cut(s) 246
StyD4I CCNGG 2 cut(s) 277, 315
StyI CCWWGG 1 cut(s) 483
TaaI ACNGT 1 cut(s) 583
TaiI ACGT 1 cut(s) 376
TaqII GACCGA 1 cut(s) 504
TasI AATT 5 cut(s) 68, 123, 216, 363, 534
TatI WGTACW 1 cut(s) 304
Tru1I TTAA 1 cut(s) 284
Tru9I TTAA 1 cut(s) 284
TseI GCWGC 2 cut(s) 136, 242
TspDTI ATGAA 3 cut(s) 135, 350, 421
VpaK11BI GGWCC 1 cut(s) 487
XapI RAATTY 1 cut(s) 534
XspI CTAG 1 cut(s) 246
ZrmI AGTACT 1 cut(s) 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.