Rmu_co8373099.1_g000001

DnaJ molecular chaperone homology domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8373099.1
Physical Location & Seq
Reverse (-)
1 .. 656
656 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8373099.1_g000001.1.cds

Sequence Viewer

Length: 555 bp
atgtatggagatgaaaagggaaatcctggatttcaatctggttcaccaggggatcatggtggatatacttacttcaccaatggtggaccaggacaaaaccagtttacctacagaccaagtgattggcagagcatgggtgggcagggaggttcccaatcgttttccttttcctttggtggccccagtggtggcccaagtccattcagttttggtatgaacgacattttctcaaacttttttggggataattctggagctggaggtcagtttggtggtttcactggttcaagcagggctcgacctgactctcagagtactccgaagagcattagggccctcagttcacagatctataagaaagaagtagttgaccagggaatgacttggctcttgttctcttatacgacctctttgaaggggcatcagcatgttgaatctctggtagaggaagttgccagctcactgaagggtgccctaaaggttggaagtgtaaactgtgacactgaggcatcactctgcaaggaccttggcatatatccacgcagaatgcccagg

Protein Analysis

185

Amino Acids

19.69

Weight (kDa)

6.82

Isoelectric Point (pI)

40.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 470
AclWI GGATC 1 cut(s) 60
AcuI CTGAAG 1 cut(s) 485
AfaI GTAC 1 cut(s) 316
AfiI CCNNNNNNNGG 1 cut(s) 188
AgsI TTSAA 4 cut(s) 35, 288, 415, 434
AjnI CCWGG 4 cut(s) 25, 46, 88, 372
AluBI AGCT 2 cut(s) 257, 459
AluI AGCT 2 cut(s) 257, 459
AlwI GGATC 1 cut(s) 60
AoxI GGCC 3 cut(s) 178, 190, 333
ApaI GGGCCC 1 cut(s) 337
AspS9I GGNCC 6 cut(s) 86, 179, 191, 333, 334, 523
AsuHPI GGTGA 2 cut(s) 36, 67
AvaII GGWCC 2 cut(s) 86, 523
BaeGI GKGCMC 2 cut(s) 337, 475
BanI GGYRCC 1 cut(s) 470
BanII GRGCYC 2 cut(s) 298, 337
BciT130I CCWGG 5 cut(s) 27, 48, 90, 374, 553
BfmI CTRYAG 1 cut(s) 109
BglII AGATCT 1 cut(s) 348
BmcAI AGTACT 1 cut(s) 316
Bme1390I CCNGG 5 cut(s) 27, 48, 90, 374, 553
Bme18I GGWCC 2 cut(s) 86, 523
BmgT120I GGNCC 6 cut(s) 86, 179, 191, 333, 334, 523
BmiI GGNNCC 4 cut(s) 151, 181, 335, 472
BmrFI CCNGG 5 cut(s) 27, 48, 90, 374, 553
BmrI ACTGGG 1 cut(s) 177
BmsI GCATC 2 cut(s) 430, 518
BmuI ACTGGG 1 cut(s) 177
BpmI CTGGAG 2 cut(s) 273, 279
BsaBI GATNNNNATC 1 cut(s) 34
BsaJI CCNNGG 4 cut(s) 47, 373, 526, 551
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse1I ACTGG 3 cut(s) 100, 183, 286
Bse8I GATNNNNATC 1 cut(s) 34
BseBI CCWGG 5 cut(s) 27, 48, 90, 374, 553
BseDI CCNNGG 4 cut(s) 47, 373, 526, 551
BseJI GATNNNNATC 1 cut(s) 34
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMII CTCAG 3 cut(s) 323, 352, 495
BseNI ACTGG 3 cut(s) 100, 183, 286
BseSI GKGCMC 2 cut(s) 337, 475
BshFI GGCC 3 cut(s) 180, 192, 335
BshNI GGYRCC 1 cut(s) 470
BslI CCNNNNNNNGG 1 cut(s) 188
BsmI GAATGC 1 cut(s) 552
BsnI GGCC 3 cut(s) 180, 192, 335
Bsp120I GGGCCC 1 cut(s) 333
Bsp1286I GDGCHC 3 cut(s) 298, 337, 475
Bsp143I GATC 2 cut(s) 52, 348
BspANI GGCC 3 cut(s) 180, 192, 335
BspCNI CTCAG 3 cut(s) 322, 351, 496
BspLI GGNNCC 4 cut(s) 151, 181, 335, 472
BspPI GGATC 1 cut(s) 60
BspQI GCTCTTC 1 cut(s) 317
BspT107I GGYRCC 1 cut(s) 470
BsrI ACTGG 3 cut(s) 100, 183, 286
BssECI CCNNGG 4 cut(s) 47, 373, 526, 551
BssMI GATC 2 cut(s) 52, 348
BssT1I CCWWGG 1 cut(s) 526
Bst2UI CCWGG 5 cut(s) 27, 48, 90, 374, 553
Bst4CI ACNGT 1 cut(s) 497
Bst6I CTCTTC 1 cut(s) 317
BstC8I GCNNGC 1 cut(s) 457
BstDEI CTNAG 3 cut(s) 309, 338, 504
BstKTI GATC 2 cut(s) 55, 351
BstMBI GATC 2 cut(s) 52, 348
BstNI CCWGG 5 cut(s) 27, 48, 90, 374, 553
BstNSI RCATGY 1 cut(s) 431
BstSCI CCNGG 4 cut(s) 25, 46, 88, 372
BstSFI CTRYAG 1 cut(s) 109
BstSLI GKGCMC 2 cut(s) 337, 475
BstX2I RGATCY 1 cut(s) 348
BstXI CCANNNNNNTGG 1 cut(s) 123
BstYI RGATCY 1 cut(s) 348
BsuRI GGCC 3 cut(s) 180, 192, 335
BtsIMutI CAGTG 4 cut(s) 190, 279, 461, 501
Cac8I GCNNGC 1 cut(s) 457
Cfr13I GGNCC 6 cut(s) 86, 179, 191, 333, 334, 523
Csp6I GTAC 1 cut(s) 315
CviAII CATG 3 cut(s) 56, 133, 428
CviJI RGCY 7 cut(s) 180, 192, 257, 296, 335, 388, 459
CviKI_1 RGCY 7 cut(s) 180, 192, 257, 296, 335, 388, 459
CviQI GTAC 1 cut(s) 315
DdeI CTNAG 3 cut(s) 309, 338, 504
DpnI GATC 2 cut(s) 54, 350
DpnII GATC 2 cut(s) 52, 348
Eam1104I CTCTTC 1 cut(s) 317
EarI CTCTTC 1 cut(s) 317
Eco130I CCWWGG 1 cut(s) 526
Eco24I GRGCYC 2 cut(s) 298, 337
Eco47I GGWCC 2 cut(s) 86, 523
Eco57I CTGAAG 1 cut(s) 485
EcoO109I RGGNCCY 3 cut(s) 333, 334, 523
EcoRII CCWGG 4 cut(s) 25, 46, 88, 372
EcoT14I CCWWGG 1 cut(s) 526
EcoT38I GRGCYC 2 cut(s) 298, 337
ErhI CCWWGG 1 cut(s) 526
FaeI CATG 3 cut(s) 59, 136, 431
FatI CATG 3 cut(s) 55, 132, 427
FriOI GRGCYC 2 cut(s) 298, 337
GsuI CTGGAG 2 cut(s) 273, 279
HaeIII GGCC 3 cut(s) 180, 192, 335
Hin1II CATG 3 cut(s) 59, 136, 431
HincII GTYRAC 1 cut(s) 370
HindII GTYRAC 1 cut(s) 370
HinfI GANTC 2 cut(s) 305, 434
HphI GGTGA 2 cut(s) 36, 67
Hpy166II GTNNAC 6 cut(s) 44, 86, 105, 344, 370, 493
Hpy188I TCNGA 2 cut(s) 312, 321
Hpy188III TCNNGA 1 cut(s) 252
Hpy8I GTNNAC 6 cut(s) 44, 86, 105, 344, 370, 493
HpyAV CCTTC 2 cut(s) 409, 460
HpyCH4III ACNGT 1 cut(s) 497
HpyCH4V TGCA 1 cut(s) 519
HpyF3I CTNAG 3 cut(s) 309, 338, 504
Hsp92II CATG 3 cut(s) 59, 136, 431
Kzo9I GATC 2 cut(s) 52, 348
LguI GCTCTTC 1 cut(s) 317
LmnI GCTCC 1 cut(s) 254
LweI GCATC 2 cut(s) 430, 518
MaeIII GTNAC 1 cut(s) 497
MalI GATC 2 cut(s) 54, 350
MboI GATC 2 cut(s) 52, 348
MboII GAAGA 1 cut(s) 334
MflI RGATCY 1 cut(s) 348
MhlI GDGCHC 3 cut(s) 298, 337, 475
MluCI AATT 1 cut(s) 247
MlyI GAGTC 1 cut(s) 299
MmeI TCCRAC 1 cut(s) 463
MnlI CCTC 6 cut(s) 140, 254, 347, 418, 439, 499
MslI CAYNNNNRTG 1 cut(s) 426
MspR9I CCNGG 5 cut(s) 27, 48, 90, 374, 553
Mva1269I GAATGC 1 cut(s) 552
MvaI CCWGG 5 cut(s) 27, 48, 90, 374, 553
NdeII GATC 2 cut(s) 52, 348
NlaIII CATG 3 cut(s) 59, 136, 431
NlaIV GGNNCC 4 cut(s) 151, 181, 335, 472
NmuCI GTSAC 1 cut(s) 497
NspI RCATGY 1 cut(s) 431
PciSI GCTCTTC 1 cut(s) 317
PctI GAATGC 1 cut(s) 552
PfeI GAWTC 1 cut(s) 434
PfoI TCCNGGA 1 cut(s) 25
PleI GAGTC 1 cut(s) 299
PpsI GAGTC 1 cut(s) 299
PpuMI RGGWCCY 1 cut(s) 523
Psp5II RGGWCCY 1 cut(s) 523
Psp6I CCWGG 4 cut(s) 25, 46, 88, 372
PspGI CCWGG 4 cut(s) 25, 46, 88, 372
PspN4I GGNNCC 4 cut(s) 151, 181, 335, 472
PspOMI GGGCCC 1 cut(s) 333
PspPI GGNCC 6 cut(s) 86, 179, 191, 333, 334, 523
PspPPI RGGWCCY 1 cut(s) 523
PsuI RGATCY 1 cut(s) 348
RsaI GTAC 1 cut(s) 316
RsaNI GTAC 1 cut(s) 315
RseI CAYNNNNRTG 1 cut(s) 426
SapI GCTCTTC 1 cut(s) 317
Sau3AI GATC 2 cut(s) 52, 348
Sau96I GGNCC 6 cut(s) 86, 179, 191, 333, 334, 523
ScaI AGTACT 1 cut(s) 316
SchI GAGTC 1 cut(s) 299
ScrFI CCNGG 5 cut(s) 27, 48, 90, 374, 553
SduI GDGCHC 3 cut(s) 298, 337, 475
SetI ASST 9 cut(s) 110, 151, 259, 265, 304, 410, 461, 483, 528
SfaNI GCATC 2 cut(s) 430, 518
SfcI CTRYAG 1 cut(s) 109
SinI GGWCC 2 cut(s) 86, 523
SmiMI CAYNNNNRTG 1 cut(s) 426
Sse9I AATT 1 cut(s) 247
StyD4I CCNGG 4 cut(s) 25, 46, 88, 372
StyI CCWWGG 1 cut(s) 526
TaaI ACNGT 1 cut(s) 497
TaqI TCGA 1 cut(s) 298
TasI AATT 1 cut(s) 247
TatI WGTACW 1 cut(s) 314
TfiI GAWTC 1 cut(s) 434
TscAI CASTG 4 cut(s) 190, 286, 468, 508
TseFI GTSAC 1 cut(s) 497
Tsp45I GTSAC 1 cut(s) 497
TspDTI ATGAA 2 cut(s) 27, 230
TspRI CASTG 4 cut(s) 190, 286, 468, 508
VpaK11BI GGWCC 2 cut(s) 86, 523
XceI RCATGY 1 cut(s) 431
ZrmI AGTACT 1 cut(s) 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.