Rmu_co8375105.1_g000001

HI0933-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8375105.1
OG0007811
Physical Location & Seq
Reverse (-)
1 .. 1120
1120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8375105.1_g000001.1.cds

Sequence Viewer

Length: 448 bp
atgtctgaatcgacgcggttgggagttcctcaaccagtttctctgcagactggaaaagctgtgataactgcatctcctactgatggtggaaaatttcttctaggcattgaaaagcgtacacccagttctgttgaatatgttgaagctgattatcttttgattgccagcggtaatggcaagcagggttacagtcttgcatctcagcttggtcattcaattgtcgatcccgtaccaagtctatttactttcaagattgaggatccacagctggccgacttgtcagggattacattccctaaagtcaaggcaaagctgaaaacagagagtgtccaaaggaatacaccacagcttacacaggttggacctgtgttagtcacacactggggattcagtgggccagcaattcttcgcttatctgcttggggtgcctgtgttttatcccgtacag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HI0933_like

Protein Analysis

149

Amino Acids

15.85

Weight (kDa)

9.13

Isoelectric Point (pI)

46.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 425
AccII CGCG 1 cut(s) 16
AciI CCGC 2 cut(s) 16, 168
AclWI GGATC 3 cut(s) 218, 254, 267
AcoI YGGCCR 1 cut(s) 270
AcsI RAATTY 1 cut(s) 92
AfaI GTAC 3 cut(s) 118, 231, 445
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 5 cut(s) 110, 134, 143, 216, 250
AluBI AGCT 6 cut(s) 59, 146, 205, 268, 313, 349
AluI AGCT 6 cut(s) 59, 146, 205, 268, 313, 349
AlwI GGATC 3 cut(s) 218, 254, 267
AoxI GGCC 2 cut(s) 270, 395
ApoI RAATTY 1 cut(s) 92
AspS9I GGNCC 2 cut(s) 362, 395
AvaII GGWCC 1 cut(s) 362
BamHI GGATCC 1 cut(s) 259
BanI GGYRCC 1 cut(s) 425
BccI CCATC 1 cut(s) 77
BfaI CTAG 1 cut(s) 101
BfmI CTRYAG 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 362
BmgT120I GGNCC 2 cut(s) 362, 395
BmiI GGNNCC 2 cut(s) 261, 427
BmrI ACTGGG 2 cut(s) 117, 391
BmsI GCATC 2 cut(s) 80, 206
BmuI ACTGGG 2 cut(s) 117, 391
BsaXI ACNNNNNCTCC 2 cut(s) 58, 88
Bsc4I CCNNNNNNNGG 1 cut(s) 83
Bse1I ACTGG 4 cut(s) 35, 55, 123, 386
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMII CTCAG 1 cut(s) 215
BseNI ACTGG 4 cut(s) 35, 55, 123, 386
Bsh1236I CGCG 1 cut(s) 16
BshFI GGCC 2 cut(s) 272, 397
BshNI GGYRCC 1 cut(s) 425
BslI CCNNNNNNNGG 1 cut(s) 83
BsnI GGCC 2 cut(s) 272, 397
Bsp143I GATC 2 cut(s) 223, 259
BspACI CCGC 2 cut(s) 16, 168
BspANI GGCC 2 cut(s) 272, 397
BspCNI CTCAG 1 cut(s) 214
BspFNI CGCG 1 cut(s) 16
BspLI GGNNCC 2 cut(s) 261, 427
BspMAI CTGCAG 1 cut(s) 48
BspPI GGATC 3 cut(s) 218, 254, 267
BspT107I GGYRCC 1 cut(s) 425
BsrI ACTGG 4 cut(s) 35, 55, 123, 386
BssMI GATC 2 cut(s) 223, 259
Bst4CI ACNGT 1 cut(s) 191
BstC8I GCNNGC 4 cut(s) 166, 179, 270, 399
BstDEI CTNAG 1 cut(s) 201
BstFNI CGCG 1 cut(s) 16
BstKTI GATC 2 cut(s) 226, 262
BstMBI GATC 2 cut(s) 223, 259
BstMWI GCNNNNNNNGC 2 cut(s) 174, 425
BstSFI CTRYAG 1 cut(s) 44
BstUI CGCG 1 cut(s) 16
BstX2I RGATCY 1 cut(s) 259
BstYI RGATCY 1 cut(s) 259
BsuRI GGCC 2 cut(s) 272, 397
BtsIMutI CAGTG 2 cut(s) 379, 397
Cac8I GCNNGC 4 cut(s) 166, 179, 270, 399
Cfr13I GGNCC 2 cut(s) 362, 395
CseI GACGC 1 cut(s) 22
Csp6I GTAC 3 cut(s) 117, 230, 444
CviJI RGCY 8 cut(s) 59, 146, 205, 268, 272, 313, 349, 397
CviKI_1 RGCY 8 cut(s) 59, 146, 205, 268, 272, 313, 349, 397
CviQI GTAC 3 cut(s) 117, 230, 444
DdeI CTNAG 1 cut(s) 201
DpnI GATC 2 cut(s) 225, 261
DpnII GATC 2 cut(s) 223, 259
EaeI YGGCCR 1 cut(s) 270
Eco47I GGWCC 1 cut(s) 362
FaiI YATR 1 cut(s) 138
FspBI CTAG 1 cut(s) 101
HaeIII GGCC 2 cut(s) 272, 397
HgaI GACGC 1 cut(s) 22
HinfI GANTC 2 cut(s) 8, 387
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 250
Hpy8I GTNNAC 1 cut(s) 119
Hpy99I CGWCG 1 cut(s) 16
HpyCH4III ACNGT 1 cut(s) 191
HpyCH4V TGCA 3 cut(s) 46, 71, 197
HpyF10VI GCNNNNNNNGC 2 cut(s) 174, 425
HpyF3I CTNAG 1 cut(s) 201
Kzo9I GATC 2 cut(s) 223, 259
LweI GCATC 2 cut(s) 80, 206
MaeI CTAG 1 cut(s) 101
MaeIII GTNAC 2 cut(s) 185, 373
MalI GATC 2 cut(s) 225, 261
MboI GATC 2 cut(s) 223, 259
MboII GAAGA 2 cut(s) 89, 398
MfeI CAATTG 1 cut(s) 216
MflI RGATCY 1 cut(s) 259
MluCI AATT 3 cut(s) 92, 216, 402
MmeI TCCRAC 1 cut(s) 340
MnlI CCTC 2 cut(s) 39, 250
MspA1I CMGCKG 2 cut(s) 168, 268
MunI CAATTG 1 cut(s) 216
MvnI CGCG 1 cut(s) 16
MwoI GCNNNNNNNGC 2 cut(s) 174, 425
NdeII GATC 2 cut(s) 223, 259
NlaIV GGNNCC 2 cut(s) 261, 427
NmuCI GTSAC 1 cut(s) 373
PfeI GAWTC 2 cut(s) 8, 387
PspN4I GGNNCC 2 cut(s) 261, 427
PspPI GGNCC 2 cut(s) 362, 395
PsrI GAACNNNNNNTAC 2 cut(s) 109, 141
PstI CTGCAG 1 cut(s) 48
PsuI RGATCY 1 cut(s) 259
PvuII CAGCTG 1 cut(s) 268
RsaI GTAC 3 cut(s) 118, 231, 445
RsaNI GTAC 3 cut(s) 117, 230, 444
Sau3AI GATC 2 cut(s) 223, 259
Sau96I GGNCC 2 cut(s) 362, 395
SetI ASST 8 cut(s) 61, 148, 207, 270, 315, 351, 360, 367
SfaNI GCATC 2 cut(s) 80, 206
SfcI CTRYAG 1 cut(s) 44
SinI GGWCC 1 cut(s) 362
Sse9I AATT 3 cut(s) 92, 216, 402
SsiI CCGC 2 cut(s) 16, 168
SspMI CTAG 1 cut(s) 101
TaaI ACNGT 1 cut(s) 191
TaqI TCGA 2 cut(s) 11, 222
TasI AATT 3 cut(s) 92, 216, 402
TfiI GAWTC 2 cut(s) 8, 387
TscAI CASTG 2 cut(s) 386, 397
TseFI GTSAC 1 cut(s) 373
Tsp45I GTSAC 1 cut(s) 373
TspRI CASTG 2 cut(s) 386, 397
VpaK11BI GGWCC 1 cut(s) 362
XapI RAATTY 1 cut(s) 92
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.