Rmu_co8379671.1_g000001

ZINC FINGER protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8379671.1
Physical Location & Seq
Forward (+)
262 .. 998
737 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8379671.1_g000001.1.cds

Sequence Viewer

Length: 642 bp
atgtcctccgccatcaagcaagaaatcccggaactctcctccgccgagaaaaccgccggaatccccaatccctcgccgatcgacatcagcagcgacagtgagagcagtagtaactccgtcgattatttttcggacatcgacgacctagagaccacttccttgatcgagtccatcacgtgcaagtcaaggaacgaacgtaacttcgatgaagcccctccggcgaagaaaacgaaacgcgacggcgaatcctcgttgcggctagggtttcctaaaccggtgccgctcaacttgccggtgacggcggcggtgccgttggcaatggctcgggtgttgccggactcaacgtgcgtgacaaggaaaattggggataaaaatagtaataatatcaatatgaatgataatcaagtaggtccagttttacggggttgcaagcagttttggaaagctggggattatgagggtgacaaggacaacgatgctaattctgccttttcttccgttggcatggatcatgcgagaattcaccctaggtttctgcattcgaatgccaccagtcacaaatgggctttgggaggtaggtacattgtgttggaacttaatcgactgatcgcggtttatgatacaatatatggccgggagtga

Protein Analysis

213

Amino Acids

23.36

Weight (kDa)

5.63

Isoelectric Point (pI)

43.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013838)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G13130 AT5G13130
fragaria_vesca FvH4_4g23220
malus_domestica MD13G1123700.v1.1
prunus_persica Prupe.1G221200_v2.0.a1
pyrus_communis pycom13g10820
rosa_chinensis RchiOBHm_Chr4g0429571
rosa_laevigata RLG00000007060
rosa_multiflora Rmu_co8379671.1_g000001
rosa_roxburghii Rroxscaffold_5G00371270
rosa_rugosa Rorug04G0237200 Rorug04G0237300
rosa_samantha Rh4AG293000 Rh4BG298700 Rh4CG314000 Rh4DG295500
rosa_wichuraiana Rw4G025360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 277, 307
AccBSI CCGCTC 1 cut(s) 283
AccII CGCG 2 cut(s) 237, 611
AciI CCGC 8 cut(s) 9, 42, 54, 256, 281, 302, 305, 611
AclWI GGATC 1 cut(s) 516
AcoI YGGCCR 1 cut(s) 631
AcsI RAATTY 1 cut(s) 519
AcvI CACGTG 1 cut(s) 177
AfaI GTAC 1 cut(s) 581
AfiI CCNNNNNNNGG 1 cut(s) 255
AgeI ACCGGT 1 cut(s) 274
AluBI AGCT 1 cut(s) 446
AluI AGCT 1 cut(s) 446
Alw26I GTCTC 1 cut(s) 143
AlwI GGATC 1 cut(s) 516
Ama87I CYCGRG 1 cut(s) 324
AoxI GGCC 1 cut(s) 631
ApeKI GCWGC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 519
AsiGI ACCGGT 1 cut(s) 274
AspA2I CCTAGG 1 cut(s) 527
AspS9I GGNCC 1 cut(s) 410
AsuC2I CCSGG 2 cut(s) 29, 635
AsuHPI GGTGA 3 cut(s) 307, 473, 515
AsuII TTCGAA 1 cut(s) 542
AvaI CYCGRG 1 cut(s) 324
AvaII GGWCC 1 cut(s) 410
AvrII CCTAGG 1 cut(s) 527
BanI GGYRCC 2 cut(s) 277, 307
BbrPI CACGTG 1 cut(s) 177
BbvI GCAGC 1 cut(s) 102
BccI CCATC 2 cut(s) 20, 179
BceAI ACGGC 3 cut(s) 256, 295, 315
BcnI CCSGG 2 cut(s) 29, 635
BcoDI GTCTC 1 cut(s) 143
BfaI CTAG 3 cut(s) 146, 260, 528
BglI GCCNNNNNGGC 1 cut(s) 218
BisI GCNGC 4 cut(s) 91, 257, 281, 303
BlnI CCTAGG 1 cut(s) 527
BlsI GCNGC 4 cut(s) 92, 258, 282, 304
Bme1390I CCNGG 2 cut(s) 29, 635
Bme18I GGWCC 1 cut(s) 410
BmeT110I CYCGRG 1 cut(s) 324
BmgT120I GGNCC 1 cut(s) 410
BmiI GGNNCC 2 cut(s) 279, 309
BmrFI CCNGG 2 cut(s) 29, 635
BmsI GCATC 1 cut(s) 466
Bpu14I TTCGAA 1 cut(s) 542
BpuMI CCSGG 2 cut(s) 29, 635
BsaAI YACGTR 1 cut(s) 177
BsaBI GATNNNNATC 1 cut(s) 83
BsaI GGTCTC 1 cut(s) 143
BsaJI CCNNGG 1 cut(s) 527
BsaWI WCCGGW 1 cut(s) 274
Bsc4I CCNNNNNNNGG 1 cut(s) 255
Bse118I RCCGGY 2 cut(s) 274, 292
Bse1I ACTGG 2 cut(s) 413, 552
Bse3DI GCAATG 1 cut(s) 324
Bse8I GATNNNNATC 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 527
BseJI GATNNNNATC 1 cut(s) 83
BseLI CCNNNNNNNGG 1 cut(s) 255
BseMI GCAATG 1 cut(s) 324
BseNI ACTGG 2 cut(s) 413, 552
BseRI GAGGAG 1 cut(s) 28
BseXI GCAGC 1 cut(s) 102
BseYI CCCAGC 1 cut(s) 446
Bsh1236I CGCG 2 cut(s) 237, 611
Bsh1285I CGRYCG 1 cut(s) 81
BshFI GGCC 1 cut(s) 633
BshNI GGYRCC 2 cut(s) 277, 307
BshTI ACCGGT 1 cut(s) 274
BsiEI CGRYCG 1 cut(s) 81
BsiHKCI CYCGRG 1 cut(s) 324
BsiSI CCGG 7 cut(s) 29, 57, 218, 275, 293, 335, 634
BslI CCNNNNNNNGG 1 cut(s) 255
BsmAI GTCTC 1 cut(s) 143
BsmI GAATGC 2 cut(s) 538, 550
BsnI GGCC 1 cut(s) 633
Bso31I GGTCTC 1 cut(s) 143
BsoBI CYCGRG 1 cut(s) 324
Bsp119I TTCGAA 1 cut(s) 542
Bsp143I GATC 4 cut(s) 78, 162, 508, 606
BspACI CCGC 8 cut(s) 9, 42, 54, 256, 281, 302, 305, 611
BspANI GGCC 1 cut(s) 633
BspFNI CGCG 2 cut(s) 237, 611
BspLI GGNNCC 2 cut(s) 279, 309
BspPI GGATC 1 cut(s) 516
BspT104I TTCGAA 1 cut(s) 542
BspT107I GGYRCC 2 cut(s) 277, 307
BspTNI GGTCTC 1 cut(s) 143
BsrBI CCGCTC 1 cut(s) 283
BsrDI GCAATG 1 cut(s) 324
BsrFI RCCGGY 2 cut(s) 274, 292
BsrI ACTGG 2 cut(s) 413, 552
BssAI RCCGGY 2 cut(s) 274, 292
BssECI CCNNGG 1 cut(s) 527
BssMI GATC 4 cut(s) 78, 162, 508, 606
BssT1I CCWWGG 1 cut(s) 527
Bst4CI ACNGT 1 cut(s) 98
BstBAI YACGTR 1 cut(s) 177
BstBI TTCGAA 1 cut(s) 542
BstC8I GCNNGC 1 cut(s) 431
BstFNI CGCG 2 cut(s) 237, 611
BstKTI GATC 4 cut(s) 81, 165, 511, 609
BstMAI GTCTC 1 cut(s) 143
BstMBI GATC 4 cut(s) 78, 162, 508, 606
BstMCI CGRYCG 1 cut(s) 81
BstMWI GCNNNNNNNGC 3 cut(s) 218, 289, 485
BstSCI CCNGG 2 cut(s) 27, 633
BstUI CGCG 2 cut(s) 237, 611
BstV1I GCAGC 1 cut(s) 102
BsuRI GGCC 1 cut(s) 633
BtsIMutI CAGTG 1 cut(s) 103
Cac8I GCNNGC 1 cut(s) 431
Cfr10I RCCGGY 2 cut(s) 274, 292
Cfr13I GGNCC 1 cut(s) 410
Csp6I GTAC 1 cut(s) 580
CspAI ACCGGT 1 cut(s) 274
CviAII CATG 2 cut(s) 505, 512
CviJI RGCY 6 cut(s) 212, 259, 323, 446, 566, 633
CviKI_1 RGCY 6 cut(s) 212, 259, 323, 446, 566, 633
CviQI GTAC 1 cut(s) 580
DpnI GATC 4 cut(s) 80, 164, 510, 608
DpnII GATC 4 cut(s) 78, 162, 508, 606
EaeI YGGCCR 1 cut(s) 631
EciI GGCGGA 1 cut(s) 31
Eco130I CCWWGG 1 cut(s) 527
Eco31I GGTCTC 1 cut(s) 143
Eco47I GGWCC 1 cut(s) 410
Eco72I CACGTG 1 cut(s) 177
Eco88I CYCGRG 1 cut(s) 324
EcoRI GAATTC 1 cut(s) 519
EcoT14I CCWWGG 1 cut(s) 527
ErhI CCWWGG 1 cut(s) 527
FaeI CATG 2 cut(s) 508, 515
FaiI YATR 7 cut(s) 392, 456, 506, 513, 618, 628, 630
FatI CATG 2 cut(s) 504, 511
Fnu4HI GCNGC 4 cut(s) 91, 257, 281, 303
Fsp4HI GCNGC 4 cut(s) 91, 257, 281, 303
FspBI CTAG 3 cut(s) 146, 260, 528
GluI GCNGC 4 cut(s) 91, 257, 281, 303
GsaI CCCAGC 1 cut(s) 450
HaeIII GGCC 1 cut(s) 633
HapII CCGG 7 cut(s) 29, 57, 218, 275, 293, 335, 634
Hin1II CATG 2 cut(s) 508, 515
HinfI GANTC 4 cut(s) 60, 167, 245, 338
HpaII CCGG 7 cut(s) 29, 57, 218, 275, 293, 335, 634
HphI GGTGA 3 cut(s) 307, 473, 515
Hpy188I TCNGA 1 cut(s) 133
Hpy99I CGWCG 3 cut(s) 122, 143, 242
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4IV ACGT 3 cut(s) 176, 196, 344
HpyCH4V TGCA 3 cut(s) 180, 429, 538
HpyF10VI GCNNNNNNNGC 3 cut(s) 218, 289, 485
HpySE526I ACGT 3 cut(s) 176, 196, 344
Hsp92II CATG 2 cut(s) 508, 515
Kzo9I GATC 4 cut(s) 78, 162, 508, 606
LpnPI CCDG 9 cut(s) 42, 70, 231, 288, 306, 348, 426, 432, 565
Lsp1109I GCAGC 1 cut(s) 102
LweI GCATC 1 cut(s) 466
MaeI CTAG 3 cut(s) 146, 260, 528
MaeII ACGT 3 cut(s) 176, 196, 344
MaeIII GTNAC 6 cut(s) 110, 197, 295, 349, 461, 554
MalI GATC 4 cut(s) 80, 164, 510, 608
MbiI CCGCTC 1 cut(s) 283
MboI GATC 4 cut(s) 78, 162, 508, 606
MboII GAAGA 2 cut(s) 235, 486
MluCI AATT 3 cut(s) 360, 481, 519
MlyI GAGTC 2 cut(s) 176, 332
MmeI TCCRAC 1 cut(s) 570
MnlI CCTC 7 cut(s) 16, 49, 82, 225, 259, 451, 566
MseI TTAA 1 cut(s) 597
MslI CAYNNNNRTG 1 cut(s) 543
MspI CCGG 7 cut(s) 29, 57, 218, 275, 293, 335, 634
MspR9I CCNGG 2 cut(s) 29, 635
Mva1269I GAATGC 2 cut(s) 538, 550
MvnI CGCG 2 cut(s) 237, 611
MwoI GCNNNNNNNGC 3 cut(s) 218, 289, 485
NciI CCSGG 2 cut(s) 29, 635
NdeII GATC 4 cut(s) 78, 162, 508, 606
NlaIII CATG 2 cut(s) 508, 515
NlaIV GGNNCC 2 cut(s) 279, 309
NmeAIII GCCGAG 1 cut(s) 70
NmuCI GTSAC 4 cut(s) 295, 349, 461, 554
NspV TTCGAA 1 cut(s) 542
PctI GAATGC 2 cut(s) 538, 550
PfeI GAWTC 2 cut(s) 60, 245
PfoI TCCNGGA 1 cut(s) 27
PinAI ACCGGT 1 cut(s) 274
PkrI GCNGC 4 cut(s) 92, 258, 282, 304
Ple19I CGATCG 1 cut(s) 81
PleI GAGTC 2 cut(s) 175, 332
PmaCI CACGTG 1 cut(s) 177
PmlI CACGTG 1 cut(s) 177
PpsI GAGTC 2 cut(s) 175, 332
Ppu21I YACGTR 1 cut(s) 177
PspCI CACGTG 1 cut(s) 177
PspFI CCCAGC 1 cut(s) 446
PspN4I GGNNCC 2 cut(s) 279, 309
PspPI GGNCC 1 cut(s) 410
PvuI CGATCG 1 cut(s) 81
RsaI GTAC 1 cut(s) 581
RsaNI GTAC 1 cut(s) 580
RseI CAYNNNNRTG 1 cut(s) 543
SaqAI TTAA 1 cut(s) 597
SatI GCNGC 4 cut(s) 91, 257, 281, 303
Sau3AI GATC 4 cut(s) 78, 162, 508, 606
Sau96I GGNCC 1 cut(s) 410
SchI GAGTC 2 cut(s) 176, 332
ScrFI CCNGG 2 cut(s) 29, 635
SetI ASST 9 cut(s) 147, 179, 199, 347, 412, 448, 533, 577, 581
SfaNI GCATC 1 cut(s) 466
SfuI TTCGAA 1 cut(s) 542
SinI GGWCC 1 cut(s) 410
SmiMI CAYNNNNRTG 1 cut(s) 543
Sse9I AATT 3 cut(s) 360, 481, 519
SsiI CCGC 8 cut(s) 9, 42, 54, 256, 281, 302, 305, 611
SspMI CTAG 3 cut(s) 146, 260, 528
StyD4I CCNGG 2 cut(s) 27, 633
StyI CCWWGG 1 cut(s) 527
TaaI ACNGT 1 cut(s) 98
TaiI ACGT 3 cut(s) 179, 199, 347
TaqI TCGA 7 cut(s) 81, 120, 138, 165, 204, 542, 601
TasI AATT 3 cut(s) 360, 481, 519
TauI GCSGC 3 cut(s) 259, 283, 305
TfiI GAWTC 2 cut(s) 60, 245
Tru1I TTAA 1 cut(s) 597
Tru9I TTAA 1 cut(s) 597
TscAI CASTG 1 cut(s) 103
TseFI GTSAC 4 cut(s) 295, 349, 461, 554
TseI GCWGC 1 cut(s) 90
Tsp45I GTSAC 4 cut(s) 295, 349, 461, 554
TspDTI ATGAA 2 cut(s) 222, 407
TspGWI ACGGA 2 cut(s) 106, 487
TspRI CASTG 1 cut(s) 103
VpaK11BI GGWCC 1 cut(s) 410
XapI RAATTY 1 cut(s) 519
XmaJI CCTAGG 1 cut(s) 527
XspI CTAG 3 cut(s) 146, 260, 528
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.