Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8401755.1

Orthogroup ID

OG0016967

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 591

Gene Structure 591 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8401755.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 346 bp

ggttcaagcacttcccaaaacattcaaggcccaaaagaaaaagcgagttgttgagggaaagagaaagcgagatgcagatgcagaggaagaggaaggagaaaagtctgaaaaaccagttggaagatcctgggtgtgggagcacttcaagaacatcgacaagcctgtatttgaggtcaaggatggtaagaagattcaaacttctgttatcatgcgagctaaatgtaattattgtgggactgatcttgcatgtgatagctacgagaatgggactagtagtcttaggaggcatatacaagatgtttgcaaaaaatatccggggagagttgatttagaggctgggcaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4413 Dimer_Tnp_hAT zf-BED

Protein Analysis

114

Amino Acids

13.06

Weight (kDa)

9.18

Isoelectric Point (pI)

49.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016967)

Species	Orthologous Gene IDs
pyrus_communis	pycom16g05860
rosa_chinensis	RchiOBHm_Chr6g0255441
rosa_laevigata	RLG00000020288
rosa_multiflora	Rmu_co8401755.1_g000001 Rmu_sc0002360.1_g000011 Rmu_sc0006904.1_g000001
rosa_roxburghii	Rroxscaffold_5G00353690
rosa_rugosa	Rorug02G0166000 Rorug05G0316600 Rorug05G0475100 Rorug05G0558700
rosa_samantha	Rh6AG075000 Rh6BG068700 Rh6BG069300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	118
AfiI	CCNNNNNNNGG	1 cut(s)	133
AgsI	TTSAA	4 cut(s)	6, 26, 146, 195
AhdI	GACNNNNNGTC	1 cut(s)	274
AhlI	ACTAGT	1 cut(s)	270
AjnI	CCWGG	1 cut(s)	126
AjuI	GAANNNNNNNTTGG	2 cut(s)	100, 132
AluBI	AGCT	2 cut(s)	216, 256
AluI	AGCT	2 cut(s)	216, 256
Alw21I	GWGCWC	1 cut(s)	142
AlwI	GGATC	1 cut(s)	118
AoxI	GGCC	1 cut(s)	28
AspS9I	GGNCC	1 cut(s)	29
AsuC2I	CCSGG	1 cut(s)	316
Bbv12I	GWGCWC	1 cut(s)	142
BccI	CCATC	1 cut(s)	174
BciT130I	CCWGG	1 cut(s)	128
BcnI	CCSGG	1 cut(s)	316
BcuI	ACTAGT	1 cut(s)	270
BfaI	CTAG	1 cut(s)	271
Bme1390I	CCNGG	2 cut(s)	128, 316
BmeRI	GACNNNNNGTC	1 cut(s)	274
BmgT120I	GGNCC	1 cut(s)	29
BmrFI	CCNGG	2 cut(s)	128, 316
BmsI	GCATC	2 cut(s)	62, 68
BpuMI	CCSGG	1 cut(s)	316
BsaJI	CCNNGG	2 cut(s)	127, 315
Bsc4I	CCNNNNNNNGG	1 cut(s)	133
Bse1I	ACTGG	1 cut(s)	114
BseBI	CCWGG	1 cut(s)	128
BseDI	CCNNGG	2 cut(s)	127, 315
BseGI	GGATG	1 cut(s)	185
BseLI	CCNNNNNNNGG	1 cut(s)	133
BseNI	ACTGG	1 cut(s)	114
BseYI	CCCAGC	1 cut(s)	336
BshFI	GGCC	1 cut(s)	30
BsiHKAI	GWGCWC	1 cut(s)	142
BsiSI	CCGG	1 cut(s)	315
BslFI	GGGAC	2 cut(s)	248, 281
BslI	CCNNNNNNNGG	1 cut(s)	133
BsmFI	GGGAC	2 cut(s)	248, 281
BsnI	GGCC	1 cut(s)	30
Bsp1286I	GDGCHC	1 cut(s)	142
Bsp143I	GATC	2 cut(s)	123, 239
BspANI	GGCC	1 cut(s)	30
BspPI	GGATC	1 cut(s)	118
BsrI	ACTGG	1 cut(s)	114
BssECI	CCNNGG	2 cut(s)	127, 315
BssMI	GATC	2 cut(s)	123, 239
Bst2UI	CCWGG	1 cut(s)	128
Bst6I	CTCTTC	1 cut(s)	82
BstC8I	GCNNGC	1 cut(s)	214
BstDEI	CTNAG	1 cut(s)	279
BstF5I	GGATG	1 cut(s)	185
BstKTI	GATC	2 cut(s)	126, 242
BstMBI	GATC	2 cut(s)	123, 239
BstNI	CCWGG	1 cut(s)	128
BstNSI	RCATGY	1 cut(s)	250
BstSCI	CCNGG	2 cut(s)	126, 314
BstX2I	RGATCY	1 cut(s)	123
BstYI	RGATCY	1 cut(s)	123
BsuRI	GGCC	1 cut(s)	30
BtsCI	GGATG	1 cut(s)	185
Cac8I	GCNNGC	1 cut(s)	214
Cfr13I	GGNCC	1 cut(s)	29
CviAII	CATG	2 cut(s)	209, 247
CviJI	RGCY	5 cut(s)	30, 161, 216, 256, 336
CviKI_1	RGCY	5 cut(s)	30, 161, 216, 256, 336
DdeI	CTNAG	1 cut(s)	279
DpnI	GATC	2 cut(s)	125, 241
DpnII	GATC	2 cut(s)	123, 239
DriI	GACNNNNNGTC	1 cut(s)	274
Eam1104I	CTCTTC	1 cut(s)	82
Eam1105I	GACNNNNNGTC	1 cut(s)	274
EarI	CTCTTC	1 cut(s)	82
EcoRII	CCWGG	1 cut(s)	126
FaeI	CATG	2 cut(s)	212, 250
FaiI	YATR	4 cut(s)	210, 248, 289, 291
FaqI	GGGAC	2 cut(s)	248, 281
FatI	CATG	2 cut(s)	208, 246
FokI	GGATG	1 cut(s)	192
FspBI	CTAG	1 cut(s)	271
GsaI	CCCAGC	1 cut(s)	340
HaeIII	GGCC	1 cut(s)	30
HapII	CCGG	1 cut(s)	315
Hin1II	CATG	2 cut(s)	212, 250
HinfI	GANTC	1 cut(s)	191
HpaII	CCGG	1 cut(s)	315
Hpy188I	TCNGA	1 cut(s)	107
Hpy188III	TCNNGA	1 cut(s)	146
HpyAV	CCTTC	1 cut(s)	87
HpyCH4V	TGCA	4 cut(s)	75, 81, 246, 304
HpyF3I	CTNAG	1 cut(s)	279
Hsp92II	CATG	2 cut(s)	212, 250
Kzo9I	GATC	2 cut(s)	123, 239
LmnI	GCTCC	1 cut(s)	137
LpnPI	CCDG	6 cut(s)	113, 127, 140, 175, 322, 328
LweI	GCATC	2 cut(s)	62, 68
MaeI	CTAG	1 cut(s)	271
MalI	GATC	2 cut(s)	125, 241
MboI	GATC	2 cut(s)	123, 239
MboII	GAAGA	3 cut(s)	99, 133, 200
MflI	RGATCY	1 cut(s)	123
MhlI	GDGCHC	1 cut(s)	142
MluCI	AATT	1 cut(s)	224
MmeI	TCCRAC	1 cut(s)	98
MnlI	CCTC	6 cut(s)	47, 77, 83, 164, 277, 326
MspI	CCGG	1 cut(s)	315
MspR9I	CCNGG	2 cut(s)	128, 316
MvaI	CCWGG	1 cut(s)	128
NciI	CCSGG	1 cut(s)	316
NdeII	GATC	2 cut(s)	123, 239
NlaIII	CATG	2 cut(s)	212, 250
NspI	RCATGY	1 cut(s)	250
PfeI	GAWTC	1 cut(s)	191
Psp6I	CCWGG	1 cut(s)	126
PspFI	CCCAGC	1 cut(s)	336
PspGI	CCWGG	1 cut(s)	126
PspPI	GGNCC	1 cut(s)	29
PsuI	RGATCY	1 cut(s)	123
Sau3AI	GATC	2 cut(s)	123, 239
Sau96I	GGNCC	1 cut(s)	29
ScrFI	CCNGG	2 cut(s)	128, 316
SduI	GDGCHC	1 cut(s)	142
SetI	ASST	3 cut(s)	175, 218, 258
SfaNI	GCATC	2 cut(s)	62, 68
SpeI	ACTAGT	1 cut(s)	270
Sse9I	AATT	1 cut(s)	224
SspMI	CTAG	1 cut(s)	271
StyD4I	CCNGG	2 cut(s)	126, 314
TaqI	TCGA	1 cut(s)	154
TasI	AATT	1 cut(s)	224
TfiI	GAWTC	1 cut(s)	191
XceI	RCATGY	1 cut(s)	250
XspI	CTAG	1 cut(s)	271

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.