Rroxscaffold_5G00353690

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
31590139 .. 31590902
764 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00353690.1

Sequence Viewer

Length: 234 bp
ATGTCTGCAAATAAGTTGAGGAAGAAGGCCAAAGAAAGAGGTGACTATCAAAGGAAAAAGTTTGTTGCTTCCAAGGCAGCAAAGGCTGGCAGCAAACAAGTCCGCCCTCAACAACATCAAGGCCTCAACATACTACAACAAGACCTACAAGCTCAAGGCCTCAACAAACCACAACTGTGCCACCAAGTTCAAGGCCTCCACAAGCTTCTACCACATCAAGCAACAAGGCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.72

Weight (kDa)

10.9

Isoelectric Point (pI)

62.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 103
AgsI TTSAA 1 cut(s) 191
AleI CACNNNNGTG 1 cut(s) 175
AluBI AGCT 2 cut(s) 152, 205
AluI AGCT 2 cut(s) 152, 205
AoxI GGCC 4 cut(s) 27, 121, 157, 193
ApeKI GCWGC 2 cut(s) 77, 90
AsuHPI GGTGA 1 cut(s) 53
BbvI GCAGC 2 cut(s) 89, 102
BisI GCNGC 2 cut(s) 78, 91
BlsI GCNGC 2 cut(s) 79, 92
BpuEI CTTGAG 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 72
BseXI GCAGC 2 cut(s) 89, 102
BshFI GGCC 4 cut(s) 29, 123, 159, 195
BsnI GGCC 4 cut(s) 29, 123, 159, 195
BspACI CCGC 1 cut(s) 103
BspANI GGCC 4 cut(s) 29, 123, 159, 195
BssECI CCNNGG 1 cut(s) 72
BssT1I CCWWGG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 177
BstC8I GCNNGC 1 cut(s) 88
BstMWI GCNNNNNNNGC 2 cut(s) 74, 83
BstV1I GCAGC 2 cut(s) 89, 102
BsuRI GGCC 4 cut(s) 29, 123, 159, 195
Cac8I GCNNGC 1 cut(s) 88
CviJI RGCY 8 cut(s) 29, 86, 123, 152, 159, 195, 205, 229
CviKI_1 RGCY 8 cut(s) 29, 86, 123, 152, 159, 195, 205, 229
EciI GGCGGA 1 cut(s) 92
Eco130I CCWWGG 1 cut(s) 72
Eco147I AGGCCT 3 cut(s) 123, 159, 195
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaiI YATR 1 cut(s) 131
Fnu4HI GCNGC 2 cut(s) 78, 91
Fsp4HI GCNGC 2 cut(s) 78, 91
GluI GCNGC 2 cut(s) 78, 91
HaeIII GGCC 4 cut(s) 29, 123, 159, 195
HindIII AAGCTT 1 cut(s) 203
HphI GGTGA 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 177
HpyCH4V TGCA 1 cut(s) 8
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 83
LpnPI CCDG 1 cut(s) 72
Lsp1109I GCAGC 2 cut(s) 89, 102
MaeIII GTNAC 1 cut(s) 41
MboII GAAGA 1 cut(s) 34
MnlI CCTC 6 cut(s) 12, 32, 117, 134, 170, 206
MslI CAYNNNNRTG 1 cut(s) 175
MwoI GCNNNNNNNGC 2 cut(s) 74, 83
NmuCI GTSAC 1 cut(s) 41
OliI CACNNNNGTG 1 cut(s) 175
PceI AGGCCT 3 cut(s) 123, 159, 195
PkrI GCNGC 2 cut(s) 79, 92
RseI CAYNNNNRTG 1 cut(s) 175
SatI GCNGC 2 cut(s) 78, 91
SetI ASST 4 cut(s) 43, 147, 154, 207
SmiMI CAYNNNNRTG 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 153
SmoI CTYRAG 1 cut(s) 153
SseBI AGGCCT 3 cut(s) 123, 159, 195
SsiI CCGC 1 cut(s) 103
StuI AGGCCT 3 cut(s) 123, 159, 195
StyI CCWWGG 1 cut(s) 72
TaaI ACNGT 1 cut(s) 177
TseFI GTSAC 1 cut(s) 41
TseI GCWGC 2 cut(s) 77, 90
Tsp45I GTSAC 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.