Rmu_co8401769.1_g000001

BAG family molecular chaperone regulator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8401769.1
OG0012594
Physical Location & Seq
Forward (+)
551 .. 1280
730 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8401769.1_g000001.1.cds

Sequence Viewer

Length: 351 bp
atgccgtcttctacgaccaaggacgaggaagttgagtgggaaatgagaccgggaggaatgttggtccagaaaagagtcgacaagtcatctgacgttgctccggttccgaacttacggcttcggattgctttcggtgctctccggtacgagatctccgccagctctcaatccacctttggggagttgaagaaggttcttacggcagagacggggttacagcccggagaccagaggctaatattcagggggaaagagcgagaaaacagggagtacttggacatgtgcggagtcaaagaccgatcaaaagtcatgctaatcgaggacccagcgagcatcgagagaagagccaat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BAG ubiquitin

Protein Analysis

117

Amino Acids

13.24

Weight (kDa)

7.84

Isoelectric Point (pI)

58.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 78
AciI CCGC 2 cut(s) 156, 285
AfaI GTAC 2 cut(s) 146, 272
AfiI CCNNNNNNNGG 1 cut(s) 177
AflIII ACRYGT 1 cut(s) 279
AgsI TTSAA 1 cut(s) 187
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
Alw21I GWGCWC 1 cut(s) 139
Alw26I GTCTC 3 cut(s) 40, 200, 219
AspS9I GGNCC 2 cut(s) 64, 322
AsuC2I CCSGG 2 cut(s) 51, 222
AvaII GGWCC 2 cut(s) 64, 322
Bbv12I GWGCWC 1 cut(s) 139
BceAI ACGGC 2 cut(s) 131, 216
BcnI CCSGG 2 cut(s) 51, 222
BcoDI GTCTC 3 cut(s) 40, 200, 219
BglII AGATCT 1 cut(s) 150
BmcAI AGTACT 1 cut(s) 272
Bme1390I CCNGG 2 cut(s) 51, 222
Bme18I GGWCC 2 cut(s) 64, 322
BmgT120I GGNCC 2 cut(s) 64, 322
BmiI GGNNCC 2 cut(s) 105, 324
BmrFI CCNGG 2 cut(s) 51, 222
BmsI GCATC 1 cut(s) 342
BpuMI CCSGG 2 cut(s) 51, 222
BsaI GGTCTC 2 cut(s) 40, 219
BsaJI CCNNGG 1 cut(s) 18
BsaWI WCCGGW 2 cut(s) 100, 141
BsaXI ACNNNNNCTCC 2 cut(s) 137, 167
Bsc4I CCNNNNNNNGG 1 cut(s) 177
BseDI CCNNGG 1 cut(s) 18
BseLI CCNNNNNNNGG 1 cut(s) 177
BseYI CCCAGC 1 cut(s) 325
BsiHKAI GWGCWC 1 cut(s) 139
BsiSI CCGG 4 cut(s) 50, 101, 142, 222
BslI CCNNNNNNNGG 1 cut(s) 177
BsmAI GTCTC 3 cut(s) 40, 200, 219
BsmBI CGTCTC 1 cut(s) 200
Bso31I GGTCTC 2 cut(s) 40, 219
Bsp1286I GDGCHC 1 cut(s) 139
Bsp143I GATC 2 cut(s) 150, 299
BspACI CCGC 2 cut(s) 156, 285
BspLI GGNNCC 2 cut(s) 105, 324
BspQI GCTCTTC 1 cut(s) 337
BspTNI GGTCTC 2 cut(s) 40, 219
BssECI CCNNGG 1 cut(s) 18
BssMI GATC 2 cut(s) 150, 299
BssT1I CCWWGG 1 cut(s) 18
Bst6I CTCTTC 1 cut(s) 337
BstC8I GCNNGC 2 cut(s) 160, 331
BstKTI GATC 2 cut(s) 153, 302
BstMAI GTCTC 3 cut(s) 40, 200, 219
BstMBI GATC 2 cut(s) 150, 299
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstNSI RCATGY 1 cut(s) 283
BstSCI CCNGG 2 cut(s) 49, 220
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
Cac8I GCNNGC 2 cut(s) 160, 331
Cfr13I GGNCC 2 cut(s) 64, 322
Csp6I GTAC 2 cut(s) 145, 271
CviAII CATG 2 cut(s) 280, 310
CviJI RGCY 5 cut(s) 118, 162, 220, 235, 347
CviKI_1 RGCY 5 cut(s) 118, 162, 220, 235, 347
CviQI GTAC 2 cut(s) 145, 271
DpnI GATC 2 cut(s) 152, 301
DpnII GATC 2 cut(s) 150, 299
Eam1104I CTCTTC 1 cut(s) 337
EarI CTCTTC 1 cut(s) 337
EciI GGCGGA 1 cut(s) 145
Eco130I CCWWGG 1 cut(s) 18
Eco31I GGTCTC 2 cut(s) 40, 219
Eco47I GGWCC 2 cut(s) 64, 322
EcoO109I RGGNCCY 1 cut(s) 322
EcoT14I CCWWGG 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 18
Esp3I CGTCTC 1 cut(s) 200
FaeI CATG 2 cut(s) 283, 313
FaiI YATR 2 cut(s) 281, 311
FatI CATG 2 cut(s) 279, 309
FblI GTMKAC 1 cut(s) 78
GsaI CCCAGC 1 cut(s) 329
HapII CCGG 4 cut(s) 50, 101, 142, 222
Hin1II CATG 2 cut(s) 283, 313
HincII GTYRAC 1 cut(s) 79
HindII GTYRAC 1 cut(s) 79
HinfI GANTC 2 cut(s) 75, 288
HpaII CCGG 4 cut(s) 50, 101, 142, 222
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 3 cut(s) 91, 108, 123
Hpy188III TCNNGA 2 cut(s) 67, 337
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 184
HpyCH4IV ACGT 1 cut(s) 93
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
HpySE526I ACGT 1 cut(s) 93
Hsp92II CATG 2 cut(s) 283, 313
Kzo9I GATC 2 cut(s) 150, 299
LguI GCTCTTC 1 cut(s) 337
LmnI GCTCC 1 cut(s) 103
LweI GCATC 1 cut(s) 342
MaeII ACGT 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 213
MalI GATC 2 cut(s) 152, 301
MboI GATC 2 cut(s) 150, 299
MboII GAAGA 1 cut(s) 199
MflI RGATCY 1 cut(s) 150
MhlI GDGCHC 1 cut(s) 139
MlyI GAGTC 2 cut(s) 84, 297
MnlI CCTC 4 cut(s) 19, 47, 225, 313
MspI CCGG 4 cut(s) 50, 101, 142, 222
MspR9I CCNGG 2 cut(s) 51, 222
MwoI GCNNNNNNNGC 1 cut(s) 134
NciI CCSGG 2 cut(s) 51, 222
NdeII GATC 2 cut(s) 150, 299
NlaIII CATG 2 cut(s) 283, 313
NlaIV GGNNCC 2 cut(s) 105, 324
NspI RCATGY 1 cut(s) 283
PciI ACATGT 1 cut(s) 279
PciSI GCTCTTC 1 cut(s) 337
PleI GAGTC 2 cut(s) 83, 296
PpsI GAGTC 2 cut(s) 83, 296
PpuMI RGGWCCY 1 cut(s) 322
PscI ACATGT 1 cut(s) 279
Psp5II RGGWCCY 1 cut(s) 322
PspFI CCCAGC 1 cut(s) 325
PspN4I GGNNCC 2 cut(s) 105, 324
PspPI GGNCC 2 cut(s) 64, 322
PspPPI RGGWCCY 1 cut(s) 322
PsuI RGATCY 1 cut(s) 150
RsaI GTAC 2 cut(s) 146, 272
RsaNI GTAC 2 cut(s) 145, 271
SalI GTCGAC 1 cut(s) 77
SapI GCTCTTC 1 cut(s) 337
Sau3AI GATC 2 cut(s) 150, 299
Sau96I GGNCC 2 cut(s) 64, 322
ScaI AGTACT 1 cut(s) 272
SchI GAGTC 2 cut(s) 84, 297
ScrFI CCNGG 2 cut(s) 51, 222
SduI GDGCHC 1 cut(s) 139
SetI ASST 4 cut(s) 96, 164, 176, 195
SfaNI GCATC 1 cut(s) 342
SinI GGWCC 2 cut(s) 64, 322
SsiI CCGC 2 cut(s) 156, 285
SspI AATATT 1 cut(s) 240
StyD4I CCNGG 2 cut(s) 49, 220
StyI CCWWGG 1 cut(s) 18
TaiI ACGT 1 cut(s) 96
TaqI TCGA 3 cut(s) 78, 318, 336
TaqII GACCGA 1 cut(s) 312
TatI WGTACW 1 cut(s) 270
VpaK11BI GGWCC 2 cut(s) 64, 322
XceI RCATGY 1 cut(s) 283
XmiI GTMKAC 1 cut(s) 78
ZrmI AGTACT 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.