Rmu_co8404831.1_g000001

Ubiquitin-conjugating enzyme E2 variant

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8404831.1
Physical Location & Seq
Forward (+)
1 .. 975
975 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8404831.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
acggtacatgaaggtcggatctatcagttgaagctgttttgtgataaagattacccagagaagccaccaactgttcgatttcattcacggattaacatgacttgtgtcaaccatgaaactggagtggtggattcgaagaaatttgggcttcttgcaaactggcagagagagtacaccatggaggatattcttacacagctgaaaaaggagatggcagctgcacataaccggaagttggtccagcccccggaaggtacctacttctag

Protein Analysis

88

Amino Acids

10.34

Weight (kDa)

8.6

Isoelectric Point (pI)

22.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013917)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 254
AccB1I GGYRCC 1 cut(s) 254
AclWI GGATC 1 cut(s) 26
AcsI RAATTY 1 cut(s) 140
AfaI GTAC 3 cut(s) 6, 173, 256
AfiI CCNNNNNNNGG 3 cut(s) 235, 247, 251
AgsI TTSAA 1 cut(s) 31
AluBI AGCT 3 cut(s) 34, 199, 218
AluI AGCT 3 cut(s) 34, 199, 218
AlwI GGATC 1 cut(s) 26
ApeKI GCWGC 2 cut(s) 215, 218
ApoI RAATTY 1 cut(s) 140
Asp718I GGTACC 1 cut(s) 254
AspS9I GGNCC 1 cut(s) 238
AsuC2I CCSGG 1 cut(s) 248
AsuII TTCGAA 1 cut(s) 134
AvaII GGWCC 1 cut(s) 238
BanI GGYRCC 1 cut(s) 254
BbvI GCAGC 2 cut(s) 205, 227
BccI CCATC 1 cut(s) 205
BcnI CCSGG 1 cut(s) 248
BfaI CTAG 1 cut(s) 265
BisI GCNGC 2 cut(s) 216, 219
BlsI GCNGC 2 cut(s) 217, 220
Bme1390I CCNGG 1 cut(s) 248
Bme18I GGWCC 1 cut(s) 238
BmgT120I GGNCC 1 cut(s) 238
BmiI GGNNCC 1 cut(s) 256
BmrFI CCNGG 1 cut(s) 248
BoxI GACNNNNGTC 1 cut(s) 104
BpmI CTGGAG 1 cut(s) 141
Bpu14I TTCGAA 1 cut(s) 134
BpuMI CCSGG 1 cut(s) 248
BsaJI CCNNGG 2 cut(s) 177, 246
BsaWI WCCGGW 1 cut(s) 228
Bsc4I CCNNNNNNNGG 3 cut(s) 235, 247, 251
Bse1I ACTGG 2 cut(s) 124, 164
BseDI CCNNGG 2 cut(s) 177, 246
BseLI CCNNNNNNNGG 3 cut(s) 235, 247, 251
BseNI ACTGG 2 cut(s) 124, 164
BseXI GCAGC 2 cut(s) 205, 227
BsgI GTGCAG 1 cut(s) 204
BshNI GGYRCC 1 cut(s) 254
BsiSI CCGG 2 cut(s) 229, 248
BslI CCNNNNNNNGG 3 cut(s) 235, 247, 251
Bsp119I TTCGAA 1 cut(s) 134
Bsp143I GATC 1 cut(s) 18
Bsp19I CCATGG 1 cut(s) 177
BspLI GGNNCC 1 cut(s) 256
BspPI GGATC 1 cut(s) 26
BspT104I TTCGAA 1 cut(s) 134
BspT107I GGYRCC 1 cut(s) 254
BsrI ACTGG 2 cut(s) 124, 164
BssECI CCNNGG 2 cut(s) 177, 246
BssMI GATC 1 cut(s) 18
BssT1I CCWWGG 1 cut(s) 177
Bst4CI ACNGT 2 cut(s) 4, 73
BstBI TTCGAA 1 cut(s) 134
BstDSI CCRYGG 1 cut(s) 177
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstPAI GACNNNNGTC 1 cut(s) 104
BstSCI CCNGG 1 cut(s) 246
BstV1I GCAGC 2 cut(s) 205, 227
BstX2I RGATCY 1 cut(s) 18
BstXI CCANNNNNNTGG 1 cut(s) 119
BstYI RGATCY 1 cut(s) 18
BtgI CCRYGG 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 238
Csp6I GTAC 3 cut(s) 5, 172, 255
CviAII CATG 4 cut(s) 8, 97, 113, 178
CviJI RGCY 6 cut(s) 34, 64, 148, 199, 218, 244
CviKI_1 RGCY 6 cut(s) 34, 64, 148, 199, 218, 244
CviQI GTAC 3 cut(s) 5, 172, 255
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
Eco130I CCWWGG 1 cut(s) 177
Eco47I GGWCC 1 cut(s) 238
EcoT14I CCWWGG 1 cut(s) 177
ErhI CCWWGG 1 cut(s) 177
FaeI CATG 4 cut(s) 11, 100, 116, 181
FaiI YATR 5 cut(s) 9, 98, 114, 179, 225
FatI CATG 4 cut(s) 7, 96, 112, 177
Fnu4HI GCNGC 2 cut(s) 216, 219
Fsp4HI GCNGC 2 cut(s) 216, 219
FspBI CTAG 1 cut(s) 265
GluI GCNGC 2 cut(s) 216, 219
GsuI CTGGAG 1 cut(s) 141
HapII CCGG 2 cut(s) 229, 248
Hin1II CATG 4 cut(s) 11, 100, 116, 181
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HinfI GANTC 1 cut(s) 131
HpaII CCGG 2 cut(s) 229, 248
Hpy166II GTNNAC 2 cut(s) 109, 174
Hpy188I TCNGA 1 cut(s) 18
Hpy8I GTNNAC 2 cut(s) 109, 174
HpyAV CCTTC 2 cut(s) 5, 245
HpyCH4III ACNGT 2 cut(s) 4, 73
HpyCH4V TGCA 2 cut(s) 155, 221
Hsp92II CATG 4 cut(s) 11, 100, 116, 181
KpnI GGTACC 1 cut(s) 258
Kzo9I GATC 1 cut(s) 18
LpnPI CCDG 6 cut(s) 69, 105, 145, 242, 254, 261
Lsp1109I GCAGC 2 cut(s) 205, 227
MaeI CTAG 1 cut(s) 265
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MboII GAAGA 1 cut(s) 148
MflI RGATCY 1 cut(s) 18
MluCI AATT 1 cut(s) 140
MnlI CCTC 1 cut(s) 175
MseI TTAA 1 cut(s) 93
MspA1I CMGCKG 2 cut(s) 199, 218
MspI CCGG 2 cut(s) 229, 248
MspR9I CCNGG 1 cut(s) 248
NciI CCSGG 1 cut(s) 248
NcoI CCATGG 1 cut(s) 177
NdeII GATC 1 cut(s) 18
NlaIII CATG 4 cut(s) 11, 100, 116, 181
NlaIV GGNNCC 1 cut(s) 256
NspV TTCGAA 1 cut(s) 134
PfeI GAWTC 1 cut(s) 131
PkrI GCNGC 2 cut(s) 217, 220
PshAI GACNNNNGTC 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 256
PspPI GGNCC 1 cut(s) 238
PsuI RGATCY 1 cut(s) 18
PvuII CAGCTG 2 cut(s) 199, 218
RsaI GTAC 3 cut(s) 6, 173, 256
RsaNI GTAC 3 cut(s) 5, 172, 255
SaqAI TTAA 1 cut(s) 93
SatI GCNGC 2 cut(s) 216, 219
Sau3AI GATC 1 cut(s) 18
Sau96I GGNCC 1 cut(s) 238
ScrFI CCNGG 1 cut(s) 248
SetI ASST 6 cut(s) 16, 36, 201, 220, 256, 260
SfuI TTCGAA 1 cut(s) 134
SinI GGWCC 1 cut(s) 238
Sse9I AATT 1 cut(s) 140
SspMI CTAG 1 cut(s) 265
StyD4I CCNGG 1 cut(s) 246
StyI CCWWGG 1 cut(s) 177
TaaI ACNGT 2 cut(s) 4, 73
TaqI TCGA 2 cut(s) 76, 134
TasI AATT 1 cut(s) 140
TatI WGTACW 1 cut(s) 171
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TseI GCWGC 2 cut(s) 215, 218
TspDTI ATGAA 3 cut(s) 24, 71, 129
TspGWI ACGGA 1 cut(s) 103
VpaK11BI GGWCC 1 cut(s) 238
XapI RAATTY 1 cut(s) 140
XspI CTAG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.