Rmu_sc0003093.1_g000044

Ubiquitin-conjugating enzyme E2 variant

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003093.1
Physical Location & Seq
Forward (+)
230302 .. 233128
2827 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003093.1_g000044.1.cds

Sequence Viewer

Length: 441 bp
atgactctaggctctggaggatccggtgttgtggtcccaagaaatttcagattgctggaggaacttgaacgtggagagaaaggtattggggatggcactgtgagctatgggatggatgatggagatgatatctacatgcgttcttggactggcaccatcattggtccccataatactgtacatgaaggtcggatctatcagttgaagctgttttgtgataaagattacccagagaagccaccaactgttcgatttcattcacggattaacatgacttgtgtcaaccatgaaactggagtggtggattcgaagaaatttgggcttcttgcaaactggcagagagagtacaccatggaggatattcttacacagctgaaaaaggagatggcagctgcacataaccggaagttggtccagcccccggaaggtacctacttctag

Protein Analysis

146

Amino Acids

16.54

Weight (kDa)

6.2

Isoelectric Point (pI)

21.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013917)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 428
AccB1I GGYRCC 2 cut(s) 152, 428
AclWI GGATC 3 cut(s) 15, 28, 200
AcsI RAATTY 2 cut(s) 43, 314
AfaI GTAC 3 cut(s) 180, 347, 430
AfiI CCNNNNNNNGG 3 cut(s) 409, 421, 425
AgsI TTSAA 2 cut(s) 68, 205
AluBI AGCT 4 cut(s) 105, 208, 373, 392
AluI AGCT 4 cut(s) 105, 208, 373, 392
AlwI GGATC 3 cut(s) 15, 28, 200
ApeKI GCWGC 2 cut(s) 389, 392
ApoI RAATTY 2 cut(s) 43, 314
Asp718I GGTACC 1 cut(s) 428
AspS9I GGNCC 3 cut(s) 34, 164, 412
AsuC2I CCSGG 1 cut(s) 422
AsuII TTCGAA 1 cut(s) 308
AvaII GGWCC 3 cut(s) 34, 164, 412
BamHI GGATCC 1 cut(s) 20
BanI GGYRCC 2 cut(s) 152, 428
BbvI GCAGC 2 cut(s) 379, 401
BccI CCATC 5 cut(s) 86, 106, 113, 164, 379
BcnI CCSGG 1 cut(s) 422
BfaI CTAG 2 cut(s) 8, 439
BisI GCNGC 2 cut(s) 390, 393
BlsI GCNGC 2 cut(s) 391, 394
Bme1390I CCNGG 1 cut(s) 422
Bme18I GGWCC 3 cut(s) 34, 164, 412
BmgT120I GGNCC 3 cut(s) 34, 164, 412
BmiI GGNNCC 5 cut(s) 22, 36, 154, 166, 430
BmrFI CCNGG 1 cut(s) 422
BoxI GACNNNNGTC 1 cut(s) 278
BpmI CTGGAG 3 cut(s) 36, 77, 315
Bpu14I TTCGAA 1 cut(s) 308
BpuMI CCSGG 1 cut(s) 422
BsaJI CCNNGG 2 cut(s) 351, 420
BsaWI WCCGGW 2 cut(s) 23, 402
Bsc4I CCNNNNNNNGG 3 cut(s) 409, 421, 425
Bse1I ACTGG 3 cut(s) 154, 298, 338
BseDI CCNNGG 2 cut(s) 351, 420
BseGI GGATG 3 cut(s) 97, 117, 121
BseLI CCNNNNNNNGG 3 cut(s) 409, 421, 425
BseNI ACTGG 3 cut(s) 154, 298, 338
BseXI GCAGC 2 cut(s) 379, 401
BsgI GTGCAG 1 cut(s) 378
BshNI GGYRCC 2 cut(s) 152, 428
BsiSI CCGG 3 cut(s) 24, 403, 422
BslFI GGGAC 2 cut(s) 20, 150
BslI CCNNNNNNNGG 3 cut(s) 409, 421, 425
BsmFI GGGAC 2 cut(s) 20, 150
Bsp119I TTCGAA 1 cut(s) 308
Bsp1407I TGTACA 1 cut(s) 178
Bsp143I GATC 2 cut(s) 20, 192
Bsp19I CCATGG 1 cut(s) 351
BspLI GGNNCC 5 cut(s) 22, 36, 154, 166, 430
BspPI GGATC 3 cut(s) 15, 28, 200
BspT104I TTCGAA 1 cut(s) 308
BspT107I GGYRCC 2 cut(s) 152, 428
BsrGI TGTACA 1 cut(s) 178
BsrI ACTGG 3 cut(s) 154, 298, 338
BssECI CCNNGG 2 cut(s) 351, 420
BssMI GATC 2 cut(s) 20, 192
BssT1I CCWWGG 1 cut(s) 351
Bst4CI ACNGT 3 cut(s) 100, 178, 247
BstAUI TGTACA 1 cut(s) 178
BstBI TTCGAA 1 cut(s) 308
BstDSI CCRYGG 1 cut(s) 351
BstF5I GGATG 3 cut(s) 97, 117, 121
BstKTI GATC 2 cut(s) 23, 195
BstMBI GATC 2 cut(s) 20, 192
BstMWI GCNNNNNNNGC 1 cut(s) 102
BstNSI RCATGY 1 cut(s) 139
BstPAI GACNNNNGTC 1 cut(s) 278
BstSCI CCNGG 1 cut(s) 420
BstV1I GCAGC 2 cut(s) 379, 401
BstX2I RGATCY 2 cut(s) 20, 192
BstXI CCANNNNNNTGG 1 cut(s) 293
BstYI RGATCY 2 cut(s) 20, 192
BtgI CCRYGG 1 cut(s) 351
BtsCI GGATG 3 cut(s) 97, 117, 121
BtsIMutI CAGTG 1 cut(s) 96
Cfr13I GGNCC 3 cut(s) 34, 164, 412
Csp6I GTAC 3 cut(s) 179, 346, 429
CviAII CATG 5 cut(s) 136, 182, 271, 287, 352
CviJI RGCY 8 cut(s) 12, 105, 208, 238, 322, 373, 392, 418
CviKI_1 RGCY 8 cut(s) 12, 105, 208, 238, 322, 373, 392, 418
CviQI GTAC 3 cut(s) 179, 346, 429
DpnI GATC 2 cut(s) 22, 194
DpnII GATC 2 cut(s) 20, 192
Eco130I CCWWGG 1 cut(s) 351
Eco32I GATATC 1 cut(s) 130
Eco47I GGWCC 3 cut(s) 34, 164, 412
EcoRV GATATC 1 cut(s) 130
EcoT14I CCWWGG 1 cut(s) 351
ErhI CCWWGG 1 cut(s) 351
FaeI CATG 5 cut(s) 139, 185, 274, 290, 355
FaiI YATR 8 cut(s) 108, 137, 171, 183, 272, 288, 353, 399
FaqI GGGAC 2 cut(s) 20, 150
FatI CATG 5 cut(s) 135, 181, 270, 286, 351
Fnu4HI GCNGC 2 cut(s) 390, 393
FokI GGATG 3 cut(s) 104, 124, 128
Fsp4HI GCNGC 2 cut(s) 390, 393
FspBI CTAG 2 cut(s) 8, 439
GluI GCNGC 2 cut(s) 390, 393
GsuI CTGGAG 3 cut(s) 36, 77, 315
HapII CCGG 3 cut(s) 24, 403, 422
Hin1II CATG 5 cut(s) 139, 185, 274, 290, 355
HincII GTYRAC 1 cut(s) 283
HindII GTYRAC 1 cut(s) 283
HinfI GANTC 2 cut(s) 4, 305
HpaII CCGG 3 cut(s) 24, 403, 422
Hpy166II GTNNAC 2 cut(s) 283, 348
Hpy188I TCNGA 2 cut(s) 50, 192
Hpy188III TCNNGA 1 cut(s) 15
Hpy8I GTNNAC 2 cut(s) 283, 348
HpyAV CCTTC 2 cut(s) 179, 419
HpyCH4III ACNGT 3 cut(s) 100, 178, 247
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 2 cut(s) 329, 395
HpyF10VI GCNNNNNNNGC 1 cut(s) 102
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 5 cut(s) 139, 185, 274, 290, 355
KpnI GGTACC 1 cut(s) 432
Kzo9I GATC 2 cut(s) 20, 192
LpnPI CCDG 9 cut(s) 37, 41, 135, 243, 279, 319, 416, 428, 435
Lsp1109I GCAGC 2 cut(s) 379, 401
MaeI CTAG 2 cut(s) 8, 439
MaeII ACGT 1 cut(s) 70
MalI GATC 2 cut(s) 22, 194
MboI GATC 2 cut(s) 20, 192
MboII GAAGA 1 cut(s) 322
MflI RGATCY 2 cut(s) 20, 192
MluCI AATT 2 cut(s) 43, 314
MmeI TCCRAC 1 cut(s) 170
MnlI CCTC 3 cut(s) 11, 52, 349
MseI TTAA 1 cut(s) 267
MspA1I CMGCKG 2 cut(s) 373, 392
MspI CCGG 3 cut(s) 24, 403, 422
MspR9I CCNGG 1 cut(s) 422
MwoI GCNNNNNNNGC 1 cut(s) 102
NciI CCSGG 1 cut(s) 422
NcoI CCATGG 1 cut(s) 351
NdeII GATC 2 cut(s) 20, 192
NlaIII CATG 5 cut(s) 139, 185, 274, 290, 355
NlaIV GGNNCC 5 cut(s) 22, 36, 154, 166, 430
NspI RCATGY 1 cut(s) 139
NspV TTCGAA 1 cut(s) 308
PfeI GAWTC 1 cut(s) 305
PkrI GCNGC 2 cut(s) 391, 394
PshAI GACNNNNGTC 1 cut(s) 278
PspN4I GGNNCC 5 cut(s) 22, 36, 154, 166, 430
PspPI GGNCC 3 cut(s) 34, 164, 412
PsuI RGATCY 2 cut(s) 20, 192
PvuII CAGCTG 2 cut(s) 373, 392
RsaI GTAC 3 cut(s) 180, 347, 430
RsaNI GTAC 3 cut(s) 179, 346, 429
SaqAI TTAA 1 cut(s) 267
SatI GCNGC 2 cut(s) 390, 393
Sau3AI GATC 2 cut(s) 20, 192
Sau96I GGNCC 3 cut(s) 34, 164, 412
ScrFI CCNGG 1 cut(s) 422
SetI ASST 9 cut(s) 73, 85, 107, 190, 210, 375, 394, 430, 434
SfuI TTCGAA 1 cut(s) 308
SinI GGWCC 3 cut(s) 34, 164, 412
Sse9I AATT 2 cut(s) 43, 314
SspMI CTAG 2 cut(s) 8, 439
StyD4I CCNGG 1 cut(s) 420
StyI CCWWGG 1 cut(s) 351
TaaI ACNGT 3 cut(s) 100, 178, 247
TaiI ACGT 1 cut(s) 73
TaqI TCGA 2 cut(s) 250, 308
TasI AATT 2 cut(s) 43, 314
TatI WGTACW 2 cut(s) 178, 345
TfiI GAWTC 1 cut(s) 305
Tru1I TTAA 1 cut(s) 267
Tru9I TTAA 1 cut(s) 267
TscAI CASTG 1 cut(s) 103
TseI GCWGC 2 cut(s) 389, 392
TspDTI ATGAA 3 cut(s) 198, 245, 303
TspGWI ACGGA 1 cut(s) 277
TspRI CASTG 1 cut(s) 103
VpaK11BI GGWCC 3 cut(s) 34, 164, 412
XapI RAATTY 2 cut(s) 43, 314
XceI RCATGY 1 cut(s) 139
XspI CTAG 2 cut(s) 8, 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.