Rmu_co8420301.1_g000001

Late embryogenesis abundant protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8420301.1
Physical Location & Seq
Reverse (-)
139 .. 777
639 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8420301.1_g000001.1.cds

Sequence Viewer

Length: 639 bp
atgtctcaagccctcacgaaatctcctaaacactgtggcgataagcacggactgaaaattaacaagctctacaagaagctattcgcagtattctctacacttttcaccacaatcctctgtttaatattacttgtttggcttatactacaccccaccaagcctcagttctctctcaaagaagctgatatctaccagctcaacctctcaggaaccaataacctcctcaactcctccgtccaactcaccttgctttccaagaatcccaatcaaaaagttggcatttactacgacgagcttcaagtctatgctcaatacaaaggccaacagatcacagtttacacatctctgcctcctttctaccaaggacacgaagacagcaatgtcttgacggcttctttgattggaaatggtttgccggtggctccctcttttggttatgaagtgggtcgtgatcagacggctgggagactggttttgaatctcaaagtgctcggacgactaaggtggaaggtaggaacttgggtgtccgggagatacagagtgaacgtggattgcgttgctgttatggctttcggtccttctctcccaacaggtccacttactactaggcaggggactcagtgttctaccactgtctga

Protein Analysis

212

Amino Acids

23.48

Weight (kDa)

9.6

Isoelectric Point (pI)

25.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015397)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 380
AfiI CCNNNNNNNGG 1 cut(s) 431
AgsI TTSAA 2 cut(s) 299, 478
AjuI GAANNNNNNNTTGG 2 cut(s) 149, 181
AloI GAACNNNNNNTCC 2 cut(s) 607, 639
AluBI AGCT 5 cut(s) 67, 79, 182, 196, 295
AluI AGCT 5 cut(s) 67, 79, 182, 196, 295
Alw21I GWGCWC 1 cut(s) 492
Alw26I GTCTC 2 cut(s) 9, 460
AoxI GGCC 1 cut(s) 319
ArsI GACNNNNNNTTYG 2 cut(s) 379, 411
Asp700I GAANNNNTTC 1 cut(s) 80
AspS9I GGNCC 2 cut(s) 575, 593
AsuC2I CCSGG 1 cut(s) 529
AsuHPI GGTGA 2 cut(s) 97, 235
AvaII GGWCC 2 cut(s) 575, 593
BbsI GAAGAC 1 cut(s) 378
Bbv12I GWGCWC 1 cut(s) 492
BceAI ACGGC 2 cut(s) 405, 474
BclI TGATCA 1 cut(s) 451
BcnI CCSGG 1 cut(s) 529
BcoDI GTCTC 2 cut(s) 9, 460
BfaI CTAG 1 cut(s) 606
Bme1390I CCNGG 1 cut(s) 529
Bme18I GGWCC 2 cut(s) 575, 593
BmgT120I GGNCC 2 cut(s) 575, 593
BmiI GGNNCC 2 cut(s) 211, 423
BmrFI CCNGG 1 cut(s) 529
BpiI GAAGAC 1 cut(s) 378
BpuMI CCSGG 1 cut(s) 529
BsaJI CCNNGG 1 cut(s) 361
BsaXI ACNNNNNCTCC 2 cut(s) 7, 37
Bsc4I CCNNNNNNNGG 1 cut(s) 431
Bse118I RCCGGY 1 cut(s) 415
Bse1I ACTGG 1 cut(s) 474
Bse3DI GCAATG 1 cut(s) 385
BseDI CCNNGG 1 cut(s) 361
BseLI CCNNNNNNNGG 1 cut(s) 431
BseMI GCAATG 1 cut(s) 385
BseMII CTCAG 3 cut(s) 176, 219, 632
BseNI ACTGG 1 cut(s) 474
BseRI GAGGAG 2 cut(s) 212, 220
BseYI CCCAGC 1 cut(s) 461
BshFI GGCC 1 cut(s) 321
BsiHKAI GWGCWC 1 cut(s) 492
BsiSI CCGG 2 cut(s) 416, 528
BslFI GGGAC 1 cut(s) 628
BslI CCNNNNNNNGG 1 cut(s) 431
BsmAI GTCTC 2 cut(s) 9, 460
BsmFI GGGAC 1 cut(s) 628
BsnI GGCC 1 cut(s) 321
Bsp1286I GDGCHC 1 cut(s) 492
Bsp143I GATC 2 cut(s) 327, 451
BspANI GGCC 1 cut(s) 321
BspCNI CTCAG 3 cut(s) 175, 218, 631
BspLI GGNNCC 2 cut(s) 211, 423
BsrDI GCAATG 1 cut(s) 385
BsrFI RCCGGY 1 cut(s) 415
BsrI ACTGG 1 cut(s) 474
BssAI RCCGGY 1 cut(s) 415
BssECI CCNNGG 1 cut(s) 361
BssMI GATC 2 cut(s) 327, 451
BssT1I CCWWGG 1 cut(s) 361
Bst4CI ACNGT 3 cut(s) 35, 334, 634
BstDEI CTNAG 4 cut(s) 162, 205, 500, 618
BstKTI GATC 2 cut(s) 330, 454
BstMAI GTCTC 2 cut(s) 9, 460
BstMBI GATC 2 cut(s) 327, 451
BstMWI GCNNNNNNNGC 1 cut(s) 566
BstSCI CCNGG 1 cut(s) 527
BstV2I GAAGAC 1 cut(s) 378
BsuRI GGCC 1 cut(s) 321
BtsIMutI CAGTG 3 cut(s) 31, 626, 630
Cfr10I RCCGGY 1 cut(s) 415
Cfr13I GGNCC 2 cut(s) 575, 593
DdeI CTNAG 4 cut(s) 162, 205, 500, 618
DpnI GATC 2 cut(s) 329, 453
DpnII GATC 2 cut(s) 327, 451
DrdI GACNNNNNNGTC 1 cut(s) 380
DseDI GACNNNNNNGTC 1 cut(s) 380
Eco130I CCWWGG 1 cut(s) 361
Eco32I GATATC 1 cut(s) 187
Eco47I GGWCC 2 cut(s) 575, 593
EcoRV GATATC 1 cut(s) 187
EcoT14I CCWWGG 1 cut(s) 361
ErhI CCWWGG 1 cut(s) 361
FaiI YATR 4 cut(s) 143, 306, 438, 566
FaqI GGGAC 1 cut(s) 628
FbaI TGATCA 1 cut(s) 451
FspBI CTAG 1 cut(s) 606
GsaI CCCAGC 1 cut(s) 465
HaeIII GGCC 1 cut(s) 321
HapII CCGG 2 cut(s) 416, 528
HinfI GANTC 3 cut(s) 259, 478, 616
HpaII CCGG 2 cut(s) 416, 528
HphI GGTGA 2 cut(s) 97, 235
Hpy166II GTNNAC 3 cut(s) 337, 544, 596
Hpy188I TCNGA 3 cut(s) 456, 494, 638
Hpy188III TCNNGA 4 cut(s) 16, 207, 385, 449
Hpy8I GTNNAC 3 cut(s) 337, 544, 596
Hpy99I CGWCG 1 cut(s) 293
HpyAV CCTTC 2 cut(s) 502, 588
HpyCH4III ACNGT 3 cut(s) 35, 334, 634
HpyCH4IV ACGT 1 cut(s) 546
HpyF10VI GCNNNNNNNGC 1 cut(s) 566
HpyF3I CTNAG 4 cut(s) 162, 205, 500, 618
HpySE526I ACGT 1 cut(s) 546
Ksp22I TGATCA 1 cut(s) 451
Kzo9I GATC 2 cut(s) 327, 451
LmnI GCTCC 1 cut(s) 427
LpnPI CCDG 8 cut(s) 192, 206, 429, 447, 455, 541, 576, 596
MaeI CTAG 1 cut(s) 606
MaeII ACGT 1 cut(s) 546
MalI GATC 2 cut(s) 329, 453
MboI GATC 2 cut(s) 327, 451
MboII GAAGA 1 cut(s) 383
MhlI GDGCHC 1 cut(s) 492
MluCI AATT 1 cut(s) 57
MlyI GAGTC 1 cut(s) 610
MmeI TCCRAC 1 cut(s) 262
MnlI CCTC 9 cut(s) 23, 125, 171, 212, 230, 233, 241, 360, 436
MroXI GAANNNNTTC 1 cut(s) 80
MseI TTAA 2 cut(s) 60, 122
MspI CCGG 2 cut(s) 416, 528
MspR9I CCNGG 1 cut(s) 529
MwoI GCNNNNNNNGC 1 cut(s) 566
NciI CCSGG 1 cut(s) 529
NdeII GATC 2 cut(s) 327, 451
NlaIV GGNNCC 2 cut(s) 211, 423
PcsI WCGNNNNNNNCGW 1 cut(s) 552
PdmI GAANNNNTTC 1 cut(s) 80
PfeI GAWTC 2 cut(s) 259, 478
PfoI TCCNGGA 1 cut(s) 527
PleI GAGTC 1 cut(s) 610
PpsI GAGTC 1 cut(s) 610
PspFI CCCAGC 1 cut(s) 461
PspN4I GGNNCC 2 cut(s) 211, 423
PspPI GGNCC 2 cut(s) 575, 593
SaqAI TTAA 2 cut(s) 60, 122
Sau3AI GATC 2 cut(s) 327, 451
Sau96I GGNCC 2 cut(s) 575, 593
SchI GAGTC 1 cut(s) 610
ScrFI CCNGG 1 cut(s) 529
SduI GDGCHC 1 cut(s) 492
SinI GGWCC 2 cut(s) 575, 593
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
Sse9I AATT 1 cut(s) 57
SspI AATATT 1 cut(s) 126
SspMI CTAG 1 cut(s) 606
StyD4I CCNGG 1 cut(s) 527
StyI CCWWGG 1 cut(s) 361
TaaI ACNGT 3 cut(s) 35, 334, 634
TaiI ACGT 1 cut(s) 549
TaqII GACCGA 1 cut(s) 563
TasI AATT 1 cut(s) 57
TfiI GAWTC 2 cut(s) 259, 478
Tru1I TTAA 2 cut(s) 60, 122
Tru9I TTAA 2 cut(s) 60, 122
TscAI CASTG 3 cut(s) 38, 626, 637
TspDTI ATGAA 1 cut(s) 453
TspGWI ACGGA 2 cut(s) 63, 223
TspRI CASTG 3 cut(s) 38, 626, 637
VpaK11BI GGWCC 2 cut(s) 575, 593
XmnI GAANNNNTTC 1 cut(s) 80
XspI CTAG 1 cut(s) 606
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.