Rmu_co8427317.1_g000001

branched-chain-amino-acid aminotransferase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8427317.1
OG0011727
Physical Location & Seq
Forward (+)
1 .. 763
763 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8427317.1_g000001.1.cds

Sequence Viewer

Length: 426 bp
acaaaactataccatgagaagtgcaatggtaattatcggaacatttcattgggaagtaaatgtactgatgctaaagtctatggaactcatgaagtgaacactggcaatggtgatgaatctgatgcttctccaggcagaacaacaaaccatggtgctgcaaatgtgggattgaagaagtttctaacggctttaattgcttctgtcattggcaatgtcaacacattcaataagtttgttgctttgctagaagaggccaacctcaccattgaagacctagctgaatcatttaggcctctaaattttcttccttacattaagtcatatgatcgcagcactatacaactattttccatctcatgtaaacaacctagaggcaacaattctcttccattctcggttcttttctcttttaacagtgaaatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Aminotran_4 Methyltransf_16

Protein Analysis

141

Amino Acids

15.5

Weight (kDa)

7.66

Isoelectric Point (pI)

33.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011727)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G27400
fragaria_vesca FvH4_6g05341 FvH4_6g05341 FvH4_6g05341 FvH4_6g05341 FvH4_6g05341
malus_domestica MD04G1209100.v1.1
prunus_persica Prupe.6G330100_v2.0.a1 Prupe.6G330100_v2.0.a1
pyrus_communis pycom04g18530
rosa_chinensis RchiOBHm_Chr3g0454111
rosa_laevigata RLG00000025482
rosa_multiflora Rmu_co8427317.1_g000001
rosa_roxburghii Rroxscaffold_6G00430900
rosa_rugosa Rorug02G0653200 Rorug02G0653300
rosa_samantha Rh3AG056000 Rh3BG057400 Rh3CG056700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 298, 420
AfaI GTAC 1 cut(s) 64
AgsI TTSAA 3 cut(s) 172, 226, 269
AjnI CCWGG 1 cut(s) 130
AjuI GAANNNNNNNTTGG 2 cut(s) 32, 64
AluBI AGCT 1 cut(s) 278
AluI AGCT 1 cut(s) 278
AoxI GGCC 2 cut(s) 252, 290
ApeKI GCWGC 2 cut(s) 155, 330
ApoI RAATTY 2 cut(s) 298, 420
AsuHPI GGTGA 2 cut(s) 122, 253
BarI GAAGNNNNNNTAC 2 cut(s) 46, 78
BbsI GAAGAC 1 cut(s) 276
BbvI GCAGC 2 cut(s) 142, 342
BccI CCATC 1 cut(s) 359
BceAI ACGGC 1 cut(s) 201
BciT130I CCWGG 1 cut(s) 132
BfaI CTAG 3 cut(s) 245, 275, 369
BisI GCNGC 2 cut(s) 156, 331
BlsI GCNGC 2 cut(s) 157, 332
Bme1390I CCNGG 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 132
BmsI GCATC 2 cut(s) 58, 112
BpiI GAAGAC 1 cut(s) 276
BpmI CTGGAG 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 148
Bse1I ACTGG 1 cut(s) 106
Bse3DI GCAATG 3 cut(s) 31, 112, 217
BseBI CCWGG 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 148
BseMI GCAATG 3 cut(s) 31, 112, 217
BseNI ACTGG 1 cut(s) 106
BseXI GCAGC 2 cut(s) 142, 342
BshFI GGCC 2 cut(s) 254, 292
BsnI GGCC 2 cut(s) 254, 292
Bsp143I GATC 1 cut(s) 325
Bsp19I CCATGG 1 cut(s) 148
BspANI GGCC 2 cut(s) 254, 292
BspHI TCATGA 1 cut(s) 88
BsrDI GCAATG 3 cut(s) 31, 112, 217
BsrI ACTGG 1 cut(s) 106
BssECI CCNNGG 1 cut(s) 148
BssMI GATC 1 cut(s) 325
BssT1I CCWWGG 1 cut(s) 148
Bst2UI CCWGG 1 cut(s) 132
Bst4CI ACNGT 1 cut(s) 416
Bst6I CTCTTC 2 cut(s) 243, 390
BstDSI CCRYGG 1 cut(s) 148
BstKTI GATC 1 cut(s) 328
BstMBI GATC 1 cut(s) 325
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 132
BstSCI CCNGG 1 cut(s) 130
BstV1I GCAGC 2 cut(s) 142, 342
BstV2I GAAGAC 1 cut(s) 276
BsuRI GGCC 2 cut(s) 254, 292
BtgI CCRYGG 1 cut(s) 148
BtsIMutI CAGTG 2 cut(s) 99, 421
CciI TCATGA 1 cut(s) 88
Csp6I GTAC 1 cut(s) 63
CviAII CATG 4 cut(s) 14, 89, 149, 357
CviJI RGCY 4 cut(s) 188, 254, 278, 292
CviKI_1 RGCY 4 cut(s) 188, 254, 278, 292
CviQI GTAC 1 cut(s) 63
DpnI GATC 1 cut(s) 327
DpnII GATC 1 cut(s) 325
Eam1104I CTCTTC 2 cut(s) 243, 390
EarI CTCTTC 2 cut(s) 243, 390
Eco130I CCWWGG 1 cut(s) 148
Eco147I AGGCCT 1 cut(s) 292
EcoRII CCWGG 1 cut(s) 130
EcoT14I CCWWGG 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 148
FaeI CATG 4 cut(s) 17, 92, 152, 360
FaiI YATR 9 cut(s) 10, 15, 81, 90, 150, 322, 324, 338, 358
FatI CATG 4 cut(s) 13, 88, 148, 356
FauNDI CATATG 1 cut(s) 322
Fnu4HI GCNGC 2 cut(s) 156, 331
Fsp4HI GCNGC 2 cut(s) 156, 331
FspBI CTAG 3 cut(s) 245, 275, 369
GluI GCNGC 2 cut(s) 156, 331
GsuI CTGGAG 1 cut(s) 114
HaeIII GGCC 2 cut(s) 254, 292
Hin1II CATG 4 cut(s) 17, 92, 152, 360
HincII GTYRAC 1 cut(s) 217
HindII GTYRAC 1 cut(s) 217
HinfI GANTC 2 cut(s) 116, 281
HphI GGTGA 2 cut(s) 122, 253
Hpy166II GTNNAC 3 cut(s) 97, 217, 362
Hpy188I TCNGA 2 cut(s) 39, 121
Hpy188III TCNNGA 1 cut(s) 89
Hpy8I GTNNAC 3 cut(s) 97, 217, 362
HpyCH4III ACNGT 1 cut(s) 416
HpyCH4V TGCA 2 cut(s) 24, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
Hsp92II CATG 4 cut(s) 17, 92, 152, 360
Kzo9I GATC 1 cut(s) 325
LpnPI CCDG 3 cut(s) 87, 117, 144
Lsp1109I GCAGC 2 cut(s) 142, 342
LweI GCATC 2 cut(s) 58, 112
MaeI CTAG 3 cut(s) 245, 275, 369
MalI GATC 1 cut(s) 327
MboI GATC 1 cut(s) 325
MboII GAAGA 5 cut(s) 184, 260, 281, 296, 377
MluCI AATT 5 cut(s) 31, 192, 298, 379, 420
MnlI CCTC 4 cut(s) 244, 269, 303, 365
MseI TTAA 4 cut(s) 191, 315, 411, 424
MspR9I CCNGG 1 cut(s) 132
MvaI CCWGG 1 cut(s) 132
MwoI GCNNNNNNNGC 1 cut(s) 194
NcoI CCATGG 1 cut(s) 148
NdeI CATATG 1 cut(s) 322
NdeII GATC 1 cut(s) 325
NlaIII CATG 4 cut(s) 17, 92, 152, 360
PagI TCATGA 1 cut(s) 88
PceI AGGCCT 1 cut(s) 292
PfeI GAWTC 2 cut(s) 116, 281
PkrI GCNGC 2 cut(s) 157, 332
Psp6I CCWGG 1 cut(s) 130
PspGI CCWGG 1 cut(s) 130
RsaI GTAC 1 cut(s) 64
RsaNI GTAC 1 cut(s) 63
SaqAI TTAA 4 cut(s) 191, 315, 411, 424
SatI GCNGC 2 cut(s) 156, 331
Sau3AI GATC 1 cut(s) 325
ScrFI CCNGG 1 cut(s) 132
SetI ASST 4 cut(s) 261, 276, 280, 370
SfaNI GCATC 2 cut(s) 58, 112
Sse9I AATT 5 cut(s) 31, 192, 298, 379, 420
SseBI AGGCCT 1 cut(s) 292
SspMI CTAG 3 cut(s) 245, 275, 369
StuI AGGCCT 1 cut(s) 292
StyD4I CCNGG 1 cut(s) 130
StyI CCWWGG 1 cut(s) 148
TaaI ACNGT 1 cut(s) 416
TasI AATT 5 cut(s) 31, 192, 298, 379, 420
TatI WGTACW 1 cut(s) 62
TfiI GAWTC 2 cut(s) 116, 281
Tru1I TTAA 4 cut(s) 191, 315, 411, 424
Tru9I TTAA 4 cut(s) 191, 315, 411, 424
TscAI CASTG 2 cut(s) 106, 421
TseI GCWGC 2 cut(s) 155, 330
TspDTI ATGAA 3 cut(s) 36, 105, 129
TspRI CASTG 2 cut(s) 106, 421
XapI RAATTY 2 cut(s) 298, 420
XspI CTAG 3 cut(s) 245, 275, 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.