Rmu_co8442897.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8442897.1
Physical Location & Seq
Reverse (-)
1 .. 1439
1439 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8442897.1_g000001.1.cds

Sequence Viewer

Length: 411 bp
atggtgggactggatgcaatgcaacgagcaaattcaaccctcgaagatttttgcaggtcttattttatgtttcatggcatggatataaacaaaccacaatcagtattccaatatcttcctatgctttcatttgtagaaagttacatttatcagcttgacgatttgaatgagaagacagtgcaagcatcaagcagtgaaatgaccatttcagaaagaggaactgcagtggaaggtcatgggaaaatttctcagttttcaaatgtgtttaaaagtgatcctttcaggccactcgaatgtctacttgaatcccatgtccttttgacaaagagaatgcaagatgaattcaagtgtggagaagagtattgggctctggaaagaaaactttgtcatgcacttaataatgaattgcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.89

Weight (kDa)

5.03

Isoelectric Point (pI)

36.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 45
AccI GTMKAC 1 cut(s) 298
AclWI GGATC 1 cut(s) 269
AcsI RAATTY 3 cut(s) 31, 243, 341
AgsI TTSAA 5 cut(s) 36, 166, 258, 305, 346
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
AlwI GGATC 1 cut(s) 269
AoxI GGCC 1 cut(s) 284
ApoI RAATTY 3 cut(s) 31, 243, 341
BanII GRGCYC 1 cut(s) 370
BbsI GAAGAC 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 222
BfuAI ACCTGC 1 cut(s) 45
BmsI GCATC 2 cut(s) 4, 194
BpiI GAAGAC 1 cut(s) 179
Bse1I ACTGG 1 cut(s) 15
Bse3DI GCAATG 1 cut(s) 24
BseGI GGATG 1 cut(s) 19
BseMI GCAATG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 263
BseNI ACTGG 1 cut(s) 15
BshFI GGCC 1 cut(s) 286
BslFI GGGAC 1 cut(s) 21
BsmFI GGGAC 1 cut(s) 21
BsmI GAATGC 1 cut(s) 336
BsnI GGCC 1 cut(s) 286
Bsp1286I GDGCHC 1 cut(s) 370
Bsp143I GATC 1 cut(s) 274
BspANI GGCC 1 cut(s) 286
BspCNI CTCAG 1 cut(s) 262
BspMAI CTGCAG 1 cut(s) 226
BspMI ACCTGC 1 cut(s) 45
BspPI GGATC 1 cut(s) 269
BsrDI GCAATG 1 cut(s) 24
BsrI ACTGG 1 cut(s) 15
BssMI GATC 1 cut(s) 274
Bst4CI ACNGT 1 cut(s) 178
Bst6I CTCTTC 1 cut(s) 351
BstC8I GCNNGC 1 cut(s) 183
BstDEI CTNAG 1 cut(s) 249
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 1 cut(s) 277
BstMBI GATC 1 cut(s) 274
BstSFI CTRYAG 1 cut(s) 222
BstV2I GAAGAC 1 cut(s) 179
BsuRI GGCC 1 cut(s) 286
BtsCI GGATG 1 cut(s) 19
BtsI GCAGTG 2 cut(s) 199, 231
BtsIMutI CAGTG 3 cut(s) 183, 199, 231
BveI ACCTGC 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 183
CviAII CATG 5 cut(s) 74, 79, 236, 311, 389
CviJI RGCY 3 cut(s) 154, 286, 368
CviKI_1 RGCY 3 cut(s) 154, 286, 368
DdeI CTNAG 1 cut(s) 249
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
DraI TTTAAA 1 cut(s) 268
Eam1104I CTCTTC 1 cut(s) 351
EarI CTCTTC 1 cut(s) 351
Eco24I GRGCYC 1 cut(s) 370
EcoRI GAATTC 1 cut(s) 341
EcoT38I GRGCYC 1 cut(s) 370
FaeI CATG 5 cut(s) 77, 82, 239, 314, 392
FaiI YATR 8 cut(s) 68, 75, 80, 86, 122, 237, 312, 390
FalI AAGNNNNNCTT 2 cut(s) 262, 294
FaqI GGGAC 1 cut(s) 21
FatI CATG 5 cut(s) 73, 78, 235, 310, 388
FblI GTMKAC 1 cut(s) 298
FokI GGATG 1 cut(s) 26
FriOI GRGCYC 1 cut(s) 370
HaeIII GGCC 1 cut(s) 286
Hin1II CATG 5 cut(s) 77, 82, 239, 314, 392
HinfI GANTC 1 cut(s) 305
Hpy166II GTNNAC 1 cut(s) 299
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 1 cut(s) 371
Hpy8I GTNNAC 1 cut(s) 299
HpyAV CCTTC 1 cut(s) 224
HpyCH4III ACNGT 1 cut(s) 178
HpyCH4V TGCA 8 cut(s) 17, 22, 54, 181, 224, 334, 392, 409
HpyF3I CTNAG 1 cut(s) 249
Hsp92II CATG 5 cut(s) 77, 82, 239, 314, 392
Kzo9I GATC 1 cut(s) 274
LpnPI CCDG 3 cut(s) 40, 268, 356
LweI GCATC 2 cut(s) 4, 194
MaeIII GTNAC 1 cut(s) 140
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MboII GAAGA 4 cut(s) 56, 107, 184, 368
MhlI GDGCHC 1 cut(s) 370
MluCI AATT 4 cut(s) 31, 243, 341, 404
MnlI CCTC 2 cut(s) 50, 209
MseI TTAA 2 cut(s) 267, 396
MslI CAYNNNNRTG 1 cut(s) 292
Mva1269I GAATGC 1 cut(s) 336
NdeII GATC 1 cut(s) 274
NlaIII CATG 5 cut(s) 77, 82, 239, 314, 392
PctI GAATGC 1 cut(s) 336
PfeI GAWTC 1 cut(s) 305
PstI CTGCAG 1 cut(s) 226
RseI CAYNNNNRTG 1 cut(s) 292
SaqAI TTAA 2 cut(s) 267, 396
Sau3AI GATC 1 cut(s) 274
SduI GDGCHC 1 cut(s) 370
SetI ASST 3 cut(s) 59, 156, 235
SfaNI GCATC 2 cut(s) 4, 194
SfcI CTRYAG 1 cut(s) 222
SmiMI CAYNNNNRTG 1 cut(s) 292
Sse9I AATT 4 cut(s) 31, 243, 341, 404
TaaI ACNGT 1 cut(s) 178
TaqI TCGA 2 cut(s) 42, 291
TasI AATT 4 cut(s) 31, 243, 341, 404
TfiI GAWTC 1 cut(s) 305
Tru1I TTAA 2 cut(s) 267, 396
Tru9I TTAA 2 cut(s) 267, 396
TscAI CASTG 3 cut(s) 183, 199, 231
TspDTI ATGAA 3 cut(s) 62, 117, 354
TspRI CASTG 3 cut(s) 183, 199, 231
XapI RAATTY 3 cut(s) 31, 243, 341
XmiI GTMKAC 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.