Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8461347.1

Orthogroup ID

OG0004655

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1849

Gene Structure 1849 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8461347.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 912 bp

tgatgcctttaagtccaagaggttgtcaactagtgacagggaagatgagcgtaaagagggacctttatcaaatagtggttctaatggccggccatcttcaaccactggaaggttactggattccagttatagatctgaaaaagttgacggttatcatgccttgcctgccaaaattggtagtatcccaagcttgccgcaaaatgcttgtaatggtctgaagacatccatgaagaaagttgtgcagcagtttaaatcctcaaaacagctgaaatccaatctctcaggtcctgaaaatgggattgctggaaagttcaaggtaatatttccatatgagctatttgtgaaactgtactcctacaacaatgtggatctttgcccatttggcctgacaaattgtgggaacagctgttatgctaatgctgtgctacagtgtttagcatttactcagcctcttacttcgtatcttcttcaaggactccattctagagcatgtcaaaaaaaggactggtgctttatatgtgaatttgaaattctgctcctgaaggcaagggaagggaagtcttcactgtccccgattaggatcttatccagaatacataaaattggaagccatcttggtcatgggaaggaagaagatgctcatgagtttttgaggtatgcagttgataccatgcaatctgtttgcctcaaggaagctggggctattggtcctttggcagaacaaacaactctagtaggcatgacctttggaggccaccttagatccaagataaagtgcatgaagtgcctcgggaaaactgagcaatttgagcggatgatggatcttactgtcgaaattgatggggcaattggaactctggaagaggctcttgcacaatttactgctactgaaactttggacggagataatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UCH zf-MYND

Protein Analysis

303

Amino Acids

33.31

Weight (kDa)

8.56

Isoelectric Point (pI)

37.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004655)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G65450 AT5G65450
fragaria_vesca	FvH4_1g19830 FvH4_1g19830 FvH4_1g19830 FvH4_1g19830 FvH4_1g19830 FvH4_1g19830 FvH4_1g19830 FvH4_1g19830 FvH4_1g19830
malus_domestica	MD01G1038200.v1.1
prunus_persica	Prupe.6G197100_v2.0.a1 Prupe.6G197100_v2.0.a1 Prupe.6G197100_v2.0.a1 Prupe.6G197100_v2.0.a1 Prupe.6G197100_v2.0.a1
pyrus_communis	pycom01g06620
rosa_chinensis	RchiOBHm_Chr2g0111521
rosa_laevigata	RLG00000017896
rosa_multiflora	Rmu_co8461347.1_g000001 Rmu_sc0005791.1_g000010
rosa_roxburghii	Rroxscaffold_2G00132250
rosa_rugosa	Rorug02G0174700 Rorug02G0174800 Rorug02G0174900
rosa_samantha	Rh2AG227500 Rh2BG239400 Rh2CG231100 Rh2DG235600
rosa_wichuraiana	Rw2G017570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	812
AciI	CCGC	2 cut(s)	195, 812
AclWI	GGATC	4 cut(s)	376, 588, 757, 829
AcoI	YGGCCR	2 cut(s)	86, 90
AcsI	RAATTY	2 cut(s)	522, 529
AcuI	CTGAAG	2 cut(s)	237, 561
AfaI	GTAC	1 cut(s)	351
AfiI	CCNNNNNNNGG	3 cut(s)	109, 294, 577
AgsI	TTSAA	4 cut(s)	100, 314, 471, 528
AhlI	ACTAGT	1 cut(s)	30
AluBI	AGCT	5 cut(s)	190, 266, 335, 406, 696
AluI	AGCT	5 cut(s)	190, 266, 335, 406, 696
AlwI	GGATC	4 cut(s)	376, 588, 757, 829
AlwNI	CAGNNNCTG	1 cut(s)	288
Ama87I	CYCGRG	1 cut(s)	789
AoxI	GGCC	4 cut(s)	86, 90, 383, 752
ApeKI	GCWGC	1 cut(s)	242
ApoI	RAATTY	2 cut(s)	522, 529
AspS9I	GGNCC	3 cut(s)	60, 285, 708
AvaI	CYCGRG	1 cut(s)	789
AvaII	GGWCC	3 cut(s)	60, 285, 708
BbsI	GAAGAC	2 cut(s)	225, 553
BbvI	GCAGC	1 cut(s)	254
BccI	CCATC	4 cut(s)	101, 619, 812, 834
BciVI	GTATCC	1 cut(s)	192
BcuI	ACTAGT	1 cut(s)	30
BfaI	CTAG	3 cut(s)	31, 484, 732
BfmI	CTRYAG	1 cut(s)	426
BfuI	GTATCC	1 cut(s)	192
BglI	GCCNNNNNGGC	1 cut(s)	382
BglII	AGATCT	1 cut(s)	132
BisI	GCNGC	2 cut(s)	195, 243
BlsI	GCNGC	2 cut(s)	196, 244
Bme18I	GGWCC	3 cut(s)	60, 285, 708
BmeT110I	CYCGRG	1 cut(s)	789
BmgT120I	GGNCC	3 cut(s)	60, 285, 708
BmiI	GGNNCC	1 cut(s)	61
BmsI	GCATC	1 cut(s)	626
BpiI	GAAGAC	2 cut(s)	225, 553
BpuEI	CTTGAG	1 cut(s)	672
BsaBI	GATNNNNATC	1 cut(s)	579
BsaJI	CCNNGG	1 cut(s)	788
Bsc4I	CCNNNNNNNGG	3 cut(s)	109, 294, 577
Bse118I	RCCGGY	1 cut(s)	88
Bse1I	ACTGG	4 cut(s)	110, 121, 124, 510
Bse8I	GATNNNNATC	1 cut(s)	579
BseDI	CCNNGG	1 cut(s)	788
BseGI	GGATG	2 cut(s)	222, 820
BseJI	GATNNNNATC	1 cut(s)	579
BseLI	CCNNNNNNNGG	3 cut(s)	109, 294, 577
BseMII	CTCAG	3 cut(s)	295, 459, 790
BseNI	ACTGG	4 cut(s)	110, 121, 124, 510
BseXI	GCAGC	1 cut(s)	254
BseYI	CCCAGC	1 cut(s)	696
BsgI	GTGCAG	1 cut(s)	261
BshFI	GGCC	4 cut(s)	88, 92, 385, 754
BsiHKCI	CYCGRG	1 cut(s)	789
BsiSI	CCGG	1 cut(s)	89
BslFI	GGGAC	2 cut(s)	73, 554
BslI	CCNNNNNNNGG	3 cut(s)	109, 294, 577
BsmFI	GGGAC	2 cut(s)	73, 554
BsnI	GGCC	4 cut(s)	88, 92, 385, 754
BsoBI	CYCGRG	1 cut(s)	789
Bsp143I	GATC	5 cut(s)	132, 368, 580, 762, 821
BspACI	CCGC	2 cut(s)	195, 812
BspANI	GGCC	4 cut(s)	88, 92, 385, 754
BspCNI	CTCAG	3 cut(s)	294, 458, 791
BspHI	TCATGA	1 cut(s)	641
BspLI	GGNNCC	1 cut(s)	61
BspPI	GGATC	4 cut(s)	376, 588, 757, 829
BsrBI	CCGCTC	1 cut(s)	812
BsrFI	RCCGGY	1 cut(s)	88
BsrI	ACTGG	4 cut(s)	110, 121, 124, 510
BssAI	RCCGGY	1 cut(s)	88
BssECI	CCNNGG	1 cut(s)	788
BssMI	GATC	5 cut(s)	132, 368, 580, 762, 821
Bst4CI	ACNGT	5 cut(s)	150, 349, 430, 568, 830
Bst6I	CTCTTC	1 cut(s)	856
BstAPI	GCANNNNNTGC	1 cut(s)	784
BstC8I	GCNNGC	3 cut(s)	90, 166, 192
BstDEI	CTNAG	4 cut(s)	281, 445, 759, 799
BstF5I	GGATG	2 cut(s)	222, 820
BstKTI	GATC	5 cut(s)	135, 371, 583, 765, 824
BstMBI	GATC	5 cut(s)	132, 368, 580, 762, 821
BstMWI	GCNNNNNNNGC	4 cut(s)	165, 382, 784, 809
BstNSI	RCATGY	1 cut(s)	493
BstSFI	CTRYAG	1 cut(s)	426
BstV1I	GCAGC	1 cut(s)	254
BstV2I	GAAGAC	2 cut(s)	225, 553
BstX2I	RGATCY	5 cut(s)	132, 368, 580, 762, 821
BstYI	RGATCY	5 cut(s)	132, 368, 580, 762, 821
BsuI	GTATCC	1 cut(s)	192
BsuRI	GGCC	4 cut(s)	88, 92, 385, 754
BtsCI	GGATG	2 cut(s)	222, 820
BtsIMutI	CAGTG	3 cut(s)	103, 435, 564
Cac8I	GCNNGC	3 cut(s)	90, 166, 192
CaiI	CAGNNNCTG	1 cut(s)	288
CciI	TCATGA	1 cut(s)	641
Cfr10I	RCCGGY	1 cut(s)	88
Cfr13I	GGNCC	3 cut(s)	60, 285, 708
Csp6I	GTAC	1 cut(s)	350
CviAII	CATG	8 cut(s)	156, 227, 490, 621, 642, 671, 740, 779
CviQI	GTAC	1 cut(s)	350
DdeI	CTNAG	4 cut(s)	281, 445, 759, 799
DpnI	GATC	5 cut(s)	134, 370, 582, 764, 823
DpnII	GATC	5 cut(s)	132, 368, 580, 762, 821
DraI	TTTAAA	1 cut(s)	251
EaeI	YGGCCR	2 cut(s)	86, 90
Eam1104I	CTCTTC	1 cut(s)	856
EarI	CTCTTC	1 cut(s)	856
Eco47I	GGWCC	3 cut(s)	60, 285, 708
Eco57I	CTGAAG	2 cut(s)	237, 561
Eco88I	CYCGRG	1 cut(s)	789
EcoO109I	RGGNCCY	2 cut(s)	60, 285
FaeI	CATG	8 cut(s)	159, 230, 493, 624, 645, 674, 743, 782
FalI	AAGNNNNNCTT	2 cut(s)	853, 885
FaqI	GGGAC	2 cut(s)	73, 554
FatI	CATG	8 cut(s)	155, 226, 489, 620, 641, 670, 739, 778
FauNDI	CATATG	1 cut(s)	329
Fnu4HI	GCNGC	2 cut(s)	195, 243
FokI	GGATG	2 cut(s)	209, 827
FseI	GGCCGGCC	1 cut(s)	92
Fsp4HI	GCNGC	2 cut(s)	195, 243
FspBI	CTAG	3 cut(s)	31, 484, 732
GluI	GCNGC	2 cut(s)	195, 243
GsaI	CCCAGC	1 cut(s)	700
HaeIII	GGCC	4 cut(s)	88, 92, 385, 754
HapII	CCGG	1 cut(s)	89
Hin1II	CATG	8 cut(s)	159, 230, 493, 624, 645, 674, 743, 782
HincII	GTYRAC	2 cut(s)	28, 146
HindII	GTYRAC	2 cut(s)	28, 146
HindIII	AAGCTT	1 cut(s)	188
HinfI	GANTC	2 cut(s)	120, 475
HpaII	CCGG	1 cut(s)	89
Hpy166II	GTNNAC	2 cut(s)	28, 146
Hpy188I	TCNGA	2 cut(s)	137, 217
Hpy188III	TCNNGA	7 cut(s)	288, 484, 539, 589, 642, 791, 858
Hpy8I	GTNNAC	2 cut(s)	28, 146
HpyAV	CCTTC	4 cut(s)	103, 536, 546, 620
HpyCH4III	ACNGT	5 cut(s)	150, 349, 430, 568, 830
HpyCH4V	TGCA	5 cut(s)	242, 660, 674, 778, 873
HpyF10VI	GCNNNNNNNGC	4 cut(s)	165, 382, 784, 809
HpyF3I	CTNAG	4 cut(s)	281, 445, 759, 799
Hsp92II	CATG	8 cut(s)	159, 230, 493, 624, 645, 674, 743, 782
KroI	GCCGGC	1 cut(s)	88
KroNI	GCCGGC	1 cut(s)	90
Kzo9I	GATC	5 cut(s)	132, 368, 580, 762, 821
LmnI	GCTCC	1 cut(s)	541
Lsp1109I	GCAGC	1 cut(s)	254
LweI	GCATC	1 cut(s)	626
MaeI	CTAG	3 cut(s)	31, 484, 732
MaeIII	GTNAC	2 cut(s)	33, 112
MalI	GATC	5 cut(s)	134, 370, 582, 764, 823
MbiI	CCGCTC	1 cut(s)	812
MboI	GATC	5 cut(s)	132, 368, 580, 762, 821
MfeI	CAATTG	1 cut(s)	847
MflI	RGATCY	5 cut(s)	132, 368, 580, 762, 821
MluCI	AATT	9 cut(s)	172, 392, 522, 529, 601, 804, 835, 847, 876
MlyI	GAGTC	1 cut(s)	469
MnlI	CCTC	9 cut(s)	13, 50, 266, 460, 646, 696, 744, 798, 857
MroNI	GCCGGC	1 cut(s)	88
MseI	TTAA	2 cut(s)	10, 250
MspA1I	CMGCKG	2 cut(s)	266, 406
MspI	CCGG	1 cut(s)	89
MunI	CAATTG	1 cut(s)	847
MwoI	GCNNNNNNNGC	4 cut(s)	165, 382, 784, 809
NaeI	GCCGGC	1 cut(s)	90
NdeI	CATATG	1 cut(s)	329
NdeII	GATC	5 cut(s)	132, 368, 580, 762, 821
NgoMIV	GCCGGC	1 cut(s)	88
NlaIII	CATG	8 cut(s)	159, 230, 493, 624, 645, 674, 743, 782
NlaIV	GGNNCC	1 cut(s)	61
NmuCI	GTSAC	1 cut(s)	33
NspI	RCATGY	1 cut(s)	493
PagI	TCATGA	1 cut(s)	641
PdiI	GCCGGC	1 cut(s)	90
PfeI	GAWTC	1 cut(s)	120
PkrI	GCNGC	2 cut(s)	196, 244
PleI	GAGTC	1 cut(s)	469
PpsI	GAGTC	1 cut(s)	469
PpuMI	RGGWCCY	2 cut(s)	60, 285
Psp5II	RGGWCCY	2 cut(s)	60, 285
PspFI	CCCAGC	1 cut(s)	696
PspN4I	GGNNCC	1 cut(s)	61
PspPI	GGNCC	3 cut(s)	60, 285, 708
PspPPI	RGGWCCY	2 cut(s)	60, 285
PstNI	CAGNNNCTG	1 cut(s)	288
PsuI	RGATCY	5 cut(s)	132, 368, 580, 762, 821
PvuII	CAGCTG	2 cut(s)	266, 406
RigI	GGCCGGCC	1 cut(s)	92
RsaI	GTAC	1 cut(s)	351
RsaNI	GTAC	1 cut(s)	350
SaqAI	TTAA	2 cut(s)	10, 250
SatI	GCNGC	2 cut(s)	195, 243
Sau3AI	GATC	5 cut(s)	132, 368, 580, 762, 821
Sau96I	GGNCC	3 cut(s)	60, 285, 708
SchI	GAGTC	1 cut(s)	469
SfaNI	GCATC	1 cut(s)	626
SfcI	CTRYAG	1 cut(s)	426
SinI	GGWCC	3 cut(s)	60, 285, 708
SmlI	CTYRAG	1 cut(s)	687
SmoI	CTYRAG	1 cut(s)	687
SpeI	ACTAGT	1 cut(s)	30
Sse9I	AATT	9 cut(s)	172, 392, 522, 529, 601, 804, 835, 847, 876
SsiI	CCGC	2 cut(s)	195, 812
SspI	AATATT	1 cut(s)	322
SspMI	CTAG	3 cut(s)	31, 484, 732
TaaI	ACNGT	5 cut(s)	150, 349, 430, 568, 830
TaqI	TCGA	1 cut(s)	832
TasI	AATT	9 cut(s)	172, 392, 522, 529, 601, 804, 835, 847, 876
TatI	WGTACW	1 cut(s)	349
TauI	GCSGC	1 cut(s)	197
TfiI	GAWTC	1 cut(s)	120
Tru1I	TTAA	2 cut(s)	10, 250
Tru9I	TTAA	2 cut(s)	10, 250
TscAI	CASTG	3 cut(s)	110, 435, 571
TseFI	GTSAC	1 cut(s)	33
TseI	GCWGC	1 cut(s)	242
Tsp45I	GTSAC	1 cut(s)	33
TspDTI	ATGAA	2 cut(s)	243, 795
TspRI	CASTG	3 cut(s)	110, 435, 571
VpaK11BI	GGWCC	3 cut(s)	60, 285, 708
XapI	RAATTY	2 cut(s)	522, 529
XbaI	TCTAGA	1 cut(s)	483
XceI	RCATGY	1 cut(s)	493
XcmI	CCANNNNNNNNNTGG	1 cut(s)	618
XspI	CTAG	3 cut(s)	31, 484, 732

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.