Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8487657.1

Orthogroup ID

OG0007987

Physical Location & Seq

Genomic Coordinates Reverse (-)

2087 .. 2420

Gene Structure 334 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8487657.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 334 bp

caggcttactcctgatcagaaagcaaagaatatccttttatctttggcaaaaactgtagaagaacaacagttagcaaaccaaattgtaggatatttggataatactagcaatgaacaaggacttggtcgtttatcaatctctgttgagcagaatgatgaggatgaagacaattacgaagatgatgaagacgacgatgacagttatgatgaggaagtcgatggtccttcacaggtcacttcatcatatgatgatgaacaagaaagtgagctggtttatttaaatgctgatagtgaaaaaaacctcgatgacttacttacagtggctgaattgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2 PPR_3

Protein Analysis

110

Amino Acids

12.38

Weight (kDa)

4.05

Isoelectric Point (pI)

47.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007987)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G59040 AT3G59040
fragaria_vesca	FvH4_6g38970 FvH4_6g38970 FvH4_6g38970 FvH4_6g38970 FvH4_6g38970
malus_domestica	MD09G1145700.v1.1
prunus_persica	Prupe.3G180100_v2.0.a1
pyrus_communis	pycom09g06600
rosa_chinensis	RchiOBHm_Chr2g0152561
rosa_laevigata	RLG00000020646
rosa_multiflora	Rmu_co8487657.1_g000002 Rmu_sc0027676.1_g000001 Rmu_sc0027677.1_g000001
rosa_roxburghii	Rroxscaffold_2G00095600
rosa_rugosa	Rorug02G0434500
rosa_samantha	Rh2AG495800 Rh2BG507600 Rh2CG482000 Rh2DG518900
rosa_wichuraiana	Rw0G004830 Rw2G040790 Rw2G041270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AjuI	GAANNNNNNNTTGG	2 cut(s)	106, 138
AluBI	AGCT	1 cut(s)	269
AluI	AGCT	1 cut(s)	269
AlwNI	CAGNNNCTG	1 cut(s)	324
AspS9I	GGNCC	1 cut(s)	222
AvaII	GGWCC	1 cut(s)	222
BbsI	GAAGAC	2 cut(s)	172, 193
BccI	CCATC	1 cut(s)	213
BclI	TGATCA	1 cut(s)	14
BfaI	CTAG	1 cut(s)	106
BfmI	CTRYAG	1 cut(s)	55
Bme18I	GGWCC	1 cut(s)	222
BmgT120I	GGNCC	1 cut(s)	222
BpiI	GAAGAC	2 cut(s)	172, 193
Bse3DI	GCAATG	1 cut(s)	116
BseGI	GGATG	1 cut(s)	167
BseMI	GCAATG	1 cut(s)	116
Bsp143I	GATC	1 cut(s)	14
BsrDI	GCAATG	1 cut(s)	116
BssMI	GATC	1 cut(s)	14
Bst4CI	ACNGT	4 cut(s)	56, 70, 201, 320
BstF5I	GGATG	1 cut(s)	167
BstKTI	GATC	1 cut(s)	17
BstMBI	GATC	1 cut(s)	14
BstSFI	CTRYAG	1 cut(s)	55
BstV2I	GAAGAC	2 cut(s)	172, 193
BtsCI	GGATG	1 cut(s)	167
BtsIMutI	CAGTG	1 cut(s)	325
CaiI	CAGNNNCTG	1 cut(s)	324
Cfr13I	GGNCC	1 cut(s)	222
CviJI	RGCY	3 cut(s)	5, 269, 324
CviKI_1	RGCY	3 cut(s)	5, 269, 324
DpnI	GATC	1 cut(s)	16
DpnII	GATC	1 cut(s)	14
DraI	TTTAAA	1 cut(s)	280
Eco47I	GGWCC	1 cut(s)	222
FaiI	YATR	3 cut(s)	205, 245, 247
FauNDI	CATATG	1 cut(s)	245
FbaI	TGATCA	1 cut(s)	14
FokI	GGATG	1 cut(s)	174
FspBI	CTAG	1 cut(s)	106
Hpy188I	TCNGA	1 cut(s)	19
Hpy188III	TCNNGA	1 cut(s)	12
Hpy99I	CGWCG	1 cut(s)	195
HpyAV	CCTTC	1 cut(s)	235
HpyCH4III	ACNGT	4 cut(s)	56, 70, 201, 320
Ksp22I	TGATCA	1 cut(s)	14
Kzo9I	GATC	1 cut(s)	14
LpnPI	CCDG	3 cut(s)	25, 216, 255
MaeI	CTAG	1 cut(s)	106
MaeIII	GTNAC	1 cut(s)	233
MalI	GATC	1 cut(s)	16
MboI	GATC	1 cut(s)	14
MboII	GAAGA	4 cut(s)	72, 177, 189, 198
MluCI	AATT	3 cut(s)	82, 170, 327
MnlI	CCTC	3 cut(s)	152, 203, 312
MseI	TTAA	1 cut(s)	279
NdeI	CATATG	1 cut(s)	245
NdeII	GATC	1 cut(s)	14
NmuCI	GTSAC	1 cut(s)	233
PflFI	GACNNNGTC	1 cut(s)	124
PspPI	GGNCC	1 cut(s)	222
PstNI	CAGNNNCTG	1 cut(s)	324
PsyI	GACNNNGTC	1 cut(s)	124
SaqAI	TTAA	1 cut(s)	279
Sau3AI	GATC	1 cut(s)	14
Sau96I	GGNCC	1 cut(s)	222
SetI	ASST	3 cut(s)	235, 271, 304
SfcI	CTRYAG	1 cut(s)	55
SgeI	CNNG	9 cut(s)	14, 24, 118, 129, 135, 243, 270, 282, 315
SinI	GGWCC	1 cut(s)	222
SmiI	ATTTAAAT	1 cut(s)	280
Sse9I	AATT	3 cut(s)	82, 170, 327
SspMI	CTAG	1 cut(s)	106
SwaI	ATTTAAAT	1 cut(s)	280
TaaI	ACNGT	4 cut(s)	56, 70, 201, 320
TaqI	TCGA	2 cut(s)	217, 304
TasI	AATT	3 cut(s)	82, 170, 327
Tru1I	TTAA	1 cut(s)	279
Tru9I	TTAA	1 cut(s)	279
TscAI	CASTG	1 cut(s)	325
TseFI	GTSAC	1 cut(s)	233
Tsp45I	GTSAC	1 cut(s)	233
TspDTI	ATGAA	5 cut(s)	127, 178, 199, 229, 268
TspRI	CASTG	1 cut(s)	325
Tth111I	GACNNNGTC	1 cut(s)	124
VpaK11BI	GGWCC	1 cut(s)	222
XspI	CTAG	1 cut(s)	106

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.