Rmu_co8505185.1_g000001

Belongs to the DEAD box helicase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8505185.1
OG0018060
Physical Location & Seq
Forward (+)
1 .. 719
719 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8505185.1_g000001.1.cds

Sequence Viewer

Length: 636 bp
atctatgatatattccagcttctcccaccaaagattcaggttggtgtgttttctgccaccatgccacctgaggccctggagatcacaaggaagtttatgaacaaacctgtgaggattcttgtgaagcgtgatgaactcaccctggaaggaattaagcagttttatgtcaatgtggacaaggaggagtggaagcttgacactttgtgtgatctttatgaaaccttggccattacccagagtgtgattttcgtgaatactcgacgcaaggttgattggttgaccgacaaaatgagaagccgggaccatacagtctctgcaacccatggagacatggaccagaacaacagagacatcatcatgagggaattccgttctgggtcatctcgtgtcttgatcaccaccgatctgttggctcgtggtattgatgtacaacaagtttcccttgttattaactatgatctgcctacccagcctgagaactacctccatagaattggtcgtagtggaagatttggtaggaagggagttgcaatcaactttgttacaaaggatgatgagagaatgctgtttgatatccagaagttctacaatgtggtagtagaggagctgccctcaaatgttgctgatctcctctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
DEAD Helicase_C WD40

Protein Analysis

211

Amino Acids

24.49

Weight (kDa)

6.38

Isoelectric Point (pI)

39.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018060)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g34110
rosa_laevigata RLG00000020077
rosa_multiflora Rmu_co8505185.1_g000001 Rmu_sc0003475.1_g000011 Rmu_sc0003475.1_g000013
rosa_roxburghii Rroxscaffold_2G00101340
rosa_rugosa Rorug02G0386100
rosa_samantha Rh2AG438500 Rh2CG425600 Rh2DG458600
rosa_wichuraiana Rw2G035860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 308
AcoI YGGCCR 1 cut(s) 225
AcsI RAATTY 1 cut(s) 365
AdeI CACNNNGTG 1 cut(s) 204
AfaI GTAC 1 cut(s) 429
AjnI CCWGG 2 cut(s) 75, 141
AluBI AGCT 3 cut(s) 19, 193, 607
AluI AGCT 3 cut(s) 19, 193, 607
Alw26I GTCTC 3 cut(s) 316, 321, 342
AlwNI CAGNNNCTG 1 cut(s) 314
AoxI GGCC 2 cut(s) 72, 225
ApeKI GCWGC 1 cut(s) 607
ApoI RAATTY 1 cut(s) 365
AspS9I GGNCC 3 cut(s) 73, 301, 334
AsuC2I CCSGG 1 cut(s) 299
AsuHPI GGTGA 2 cut(s) 130, 388
AvaII GGWCC 2 cut(s) 301, 334
AxyI CCTNAGG 1 cut(s) 69
BalI TGGCCA 1 cut(s) 227
BauI CACGAG 2 cut(s) 384, 414
BbvI GCAGC 1 cut(s) 594
BciT130I CCWGG 2 cut(s) 77, 143
BclI TGATCA 1 cut(s) 393
BcnI CCSGG 1 cut(s) 299
BcoDI GTCTC 3 cut(s) 316, 321, 342
BisI GCNGC 1 cut(s) 608
BlsI GCNGC 1 cut(s) 609
Bme1390I CCNGG 3 cut(s) 77, 143, 299
Bme18I GGWCC 2 cut(s) 301, 334
BmgT120I GGNCC 3 cut(s) 73, 301, 334
BmiI GGNNCC 1 cut(s) 302
BmrFI CCNGG 3 cut(s) 77, 143, 299
BplI GAGNNNNNCTC 2 cut(s) 596, 628
BpmI CTGGAG 1 cut(s) 98
BpuMI CCSGG 1 cut(s) 299
BsaJI CCNNGG 4 cut(s) 75, 141, 222, 322
Bse21I CCTNAGG 1 cut(s) 69
BseBI CCWGG 2 cut(s) 77, 143
BseDI CCNNGG 4 cut(s) 75, 141, 222, 322
BseGI GGATG 1 cut(s) 556
BseMII CTCAG 2 cut(s) 60, 465
BseRI GAGGAG 3 cut(s) 197, 617, 620
BseXI GCAGC 1 cut(s) 594
BseYI CCCAGC 1 cut(s) 468
BshFI GGCC 2 cut(s) 74, 227
BsiSI CCGG 1 cut(s) 298
BslFI GGGAC 1 cut(s) 314
BsmAI GTCTC 3 cut(s) 316, 321, 342
BsmFI GGGAC 1 cut(s) 314
BsmI GAATGC 1 cut(s) 567
BsnI GGCC 2 cut(s) 74, 227
Bsp1407I TGTACA 1 cut(s) 427
Bsp143I GATC 6 cut(s) 81, 208, 393, 403, 457, 625
Bsp19I CCATGG 1 cut(s) 322
BspANI GGCC 2 cut(s) 74, 227
BspCNI CTCAG 2 cut(s) 61, 466
BspHI TCATGA 1 cut(s) 357
BspLI GGNNCC 1 cut(s) 302
BsrGI TGTACA 1 cut(s) 427
BssECI CCNNGG 4 cut(s) 75, 141, 222, 322
BssMI GATC 6 cut(s) 81, 208, 393, 403, 457, 625
BssSI CACGAG 2 cut(s) 384, 414
BssT1I CCWWGG 2 cut(s) 222, 322
Bst2BI CACGAG 2 cut(s) 384, 414
Bst2UI CCWGG 2 cut(s) 77, 143
Bst4CI ACNGT 1 cut(s) 310
BstAUI TGTACA 1 cut(s) 427
BstDEI CTNAG 2 cut(s) 69, 474
BstDSI CCRYGG 1 cut(s) 322
BstF5I GGATG 1 cut(s) 556
BstKTI GATC 6 cut(s) 84, 211, 396, 406, 460, 628
BstMAI GTCTC 3 cut(s) 316, 321, 342
BstMBI GATC 6 cut(s) 81, 208, 393, 403, 457, 625
BstMWI GCNNNNNNNGC 1 cut(s) 469
BstNI CCWGG 2 cut(s) 77, 143
BstSCI CCNGG 3 cut(s) 75, 141, 297
BstV1I GCAGC 1 cut(s) 594
BstXI CCANNNNNNTGG 1 cut(s) 494
Bsu36I CCTNAGG 1 cut(s) 69
BsuRI GGCC 2 cut(s) 74, 227
BtgI CCRYGG 1 cut(s) 322
BtsCI GGATG 1 cut(s) 556
CaiI CAGNNNCTG 1 cut(s) 314
CciI TCATGA 1 cut(s) 357
Cfr13I GGNCC 3 cut(s) 73, 301, 334
CseI GACGC 1 cut(s) 270
Csp6I GTAC 1 cut(s) 428
CviAII CATG 4 cut(s) 61, 323, 331, 358
CviJI RGCY 8 cut(s) 19, 74, 193, 227, 297, 413, 472, 607
CviKI_1 RGCY 8 cut(s) 19, 74, 193, 227, 297, 413, 472, 607
CviQI GTAC 1 cut(s) 428
DdeI CTNAG 2 cut(s) 69, 474
DpnI GATC 6 cut(s) 83, 210, 395, 405, 459, 627
DpnII GATC 6 cut(s) 81, 208, 393, 403, 457, 625
DraIII CACNNNGTG 1 cut(s) 204
DrdI GACNNNNNNGTC 1 cut(s) 308
DseDI GACNNNNNNGTC 1 cut(s) 308
EaeI YGGCCR 1 cut(s) 225
Eco130I CCWWGG 2 cut(s) 222, 322
Eco32I GATATC 1 cut(s) 574
Eco47I GGWCC 2 cut(s) 301, 334
Eco81I CCTNAGG 1 cut(s) 69
EcoO109I RGGNCCY 1 cut(s) 73
EcoRI GAATTC 1 cut(s) 365
EcoRII CCWGG 2 cut(s) 75, 141
EcoRV GATATC 1 cut(s) 574
EcoT14I CCWWGG 2 cut(s) 222, 322
ErhI CCWWGG 2 cut(s) 222, 322
FaeI CATG 4 cut(s) 64, 326, 334, 361
FalI AAGNNNNNCTT 2 cut(s) 426, 458
FaqI GGGAC 1 cut(s) 314
FatI CATG 4 cut(s) 60, 322, 330, 357
FbaI TGATCA 1 cut(s) 393
Fnu4HI GCNGC 1 cut(s) 608
FokI GGATG 1 cut(s) 563
Fsp4HI GCNGC 1 cut(s) 608
GluI GCNGC 1 cut(s) 608
GsaI CCCAGC 1 cut(s) 472
GsuI CTGGAG 1 cut(s) 98
HaeIII GGCC 2 cut(s) 74, 227
HapII CCGG 1 cut(s) 298
HgaI GACGC 1 cut(s) 270
Hin1II CATG 4 cut(s) 64, 326, 334, 361
HincII GTYRAC 1 cut(s) 279
HindII GTYRAC 1 cut(s) 279
HindIII AAGCTT 1 cut(s) 191
HinfI GANTC 2 cut(s) 34, 115
HpaII CCGG 1 cut(s) 298
HphI GGTGA 2 cut(s) 130, 388
Hpy166II GTNNAC 2 cut(s) 175, 279
Hpy188I TCNGA 1 cut(s) 635
Hpy188III TCNNGA 4 cut(s) 250, 358, 391, 577
Hpy8I GTNNAC 2 cut(s) 175, 279
Hpy99I CGWCG 1 cut(s) 264
HpyAV CCTTC 2 cut(s) 140, 514
HpyCH4III ACNGT 1 cut(s) 310
HpyCH4V TGCA 2 cut(s) 317, 530
HpyF10VI GCNNNNNNNGC 1 cut(s) 469
HpyF3I CTNAG 2 cut(s) 69, 474
Hsp92II CATG 4 cut(s) 64, 326, 334, 361
Ksp22I TGATCA 1 cut(s) 393
Kzo9I GATC 6 cut(s) 81, 208, 393, 403, 457, 625
LmnI GCTCC 1 cut(s) 604
Lsp1109I GCAGC 1 cut(s) 594
MaeIII GTNAC 1 cut(s) 541
MalI GATC 6 cut(s) 83, 210, 395, 405, 459, 627
MboI GATC 6 cut(s) 81, 208, 393, 403, 457, 625
MboII GAAGA 1 cut(s) 519
MlsI TGGCCA 1 cut(s) 227
MluCI AATT 3 cut(s) 150, 365, 492
MluNI TGGCCA 1 cut(s) 227
MnlI CCTC 7 cut(s) 64, 105, 175, 354, 494, 595, 622
Mox20I TGGCCA 1 cut(s) 227
MscI TGGCCA 1 cut(s) 227
MseI TTAA 2 cut(s) 153, 450
MslI CAYNNNNRTG 1 cut(s) 356
Msp20I TGGCCA 1 cut(s) 227
MspI CCGG 1 cut(s) 298
MspR9I CCNGG 3 cut(s) 77, 143, 299
Mva1269I GAATGC 1 cut(s) 567
MvaI CCWGG 2 cut(s) 77, 143
MwoI GCNNNNNNNGC 1 cut(s) 469
NciI CCSGG 1 cut(s) 299
NcoI CCATGG 1 cut(s) 322
NdeII GATC 6 cut(s) 81, 208, 393, 403, 457, 625
NlaIII CATG 4 cut(s) 64, 326, 334, 361
NlaIV GGNNCC 1 cut(s) 302
PagI TCATGA 1 cut(s) 357
PctI GAATGC 1 cut(s) 567
PfeI GAWTC 2 cut(s) 34, 115
PkrI GCNGC 1 cut(s) 609
Psp6I CCWGG 2 cut(s) 75, 141
PspFI CCCAGC 1 cut(s) 468
PspGI CCWGG 2 cut(s) 75, 141
PspN4I GGNNCC 1 cut(s) 302
PspPI GGNCC 3 cut(s) 73, 301, 334
PstNI CAGNNNCTG 1 cut(s) 314
RsaI GTAC 1 cut(s) 429
RsaNI GTAC 1 cut(s) 428
RseI CAYNNNNRTG 1 cut(s) 356
SaqAI TTAA 2 cut(s) 153, 450
SatI GCNGC 1 cut(s) 608
Sau3AI GATC 6 cut(s) 81, 208, 393, 403, 457, 625
Sau96I GGNCC 3 cut(s) 73, 301, 334
ScrFI CCNGG 3 cut(s) 77, 143, 299
SetI ASST 9 cut(s) 21, 42, 70, 109, 195, 224, 270, 486, 609
SinI GGWCC 2 cut(s) 301, 334
SmiMI CAYNNNNRTG 1 cut(s) 356
Sse9I AATT 3 cut(s) 150, 365, 492
StyD4I CCNGG 3 cut(s) 75, 141, 297
StyI CCWWGG 2 cut(s) 222, 322
TaaI ACNGT 1 cut(s) 310
TaqI TCGA 1 cut(s) 259
TaqII GACCGA 1 cut(s) 296
TasI AATT 3 cut(s) 150, 365, 492
TatI WGTACW 1 cut(s) 427
TfiI GAWTC 2 cut(s) 34, 115
Tru1I TTAA 2 cut(s) 153, 450
Tru9I TTAA 2 cut(s) 153, 450
TseI GCWGC 1 cut(s) 607
TspDTI ATGAA 3 cut(s) 113, 147, 231
TspGWI ACGGA 1 cut(s) 359
VpaK11BI GGWCC 2 cut(s) 301, 334
XapI RAATTY 1 cut(s) 365
XcmI CCANNNNNNNNNTGG 1 cut(s) 406
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.