Rmu_co8516769.1_g000001
MYB Family

two-component response regulator

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8516769.1
Physical Location & Seq
Forward (+)
80 .. 1790
1711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8516769.1_g000001.1.cds

Sequence Viewer

Length: 1269 bp
atgaatgaggataagcttactagagaaaatgtggcaagccatctccagaaatttagactatatcttaaaagaatcagttgcgtagcaaaccaacaagctaatatgatggcagctataggcagttcggattcttcttatttgcgaatgggttctttcaacggagttcgaaattaccatgcattgactggacctgggcagtttaacaacactggttttagatccatgccacttaatgggatgattggtagagtgaacactcctgctggtctgggtcagcattgcctgccatcttcaggatcaattaagttgggtcatggacaacatccaagcaactcgattcttgatcagggcttatttcctggaaaccgtaatggaagtatgtttcaaggaaatttggaacttgatcaacggcacagtaaaggtgctacctccgtgcgggacctctctgctggtatcaatggtacaccagtttatcccattcccggtggactttcagacgcaaaactgattgtcagtagatcaagtgatgctgttgggcttacagacgatttaatcttaagacatcctcgagattttgaaggtggaagagaatatgtaaaccagtcttcactttcagtggctcctttaaaatctgaattttctgccccctttctggatcatggtaggttgaatgacagctggtcaagcgctgctcagtcatctgctttccgatcaaattcttttccatcaagtaatacgagggacaatatacctgttgtaatgtcctcgcaactgcggaactgtcagtttgatgttccttcaataaattcagtctccagtcaattgcaggatccaagaacagaattgctgatccaaccttctgcaattagtagcactgctgagcagataattgatagtgatccaactcaggggtgggtgtggatggatcataagcaggattccccataccaccactcggatgctataagtagctccatgaactctttgatgcctgctaatattcccgtggcttttgaccagaatttggactcaaaaggcacaactttacaaagaaacatggacttcaattccattggacagtcaaattttcttgatcctttgcacataaaatttgatgaggttgaaagatcagtggaggcatcaatgaacttgaagccaggtgagtgcaatgacaaatcagctggaaaagagatgaggcgacatcaatgggaaggagacttcaacatgagaagtggaaagatccagaacgtagtgttctttgcgagatga

Protein Analysis

422

Amino Acids

46.32

Weight (kDa)

6.67

Isoelectric Point (pI)

51.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 233, 1024
AciI CCGC 2 cut(s) 436, 775
AcsI RAATTY 8 cut(s) 50, 391, 635, 715, 805, 1021, 1084, 1109
AcuI CTGAAG 1 cut(s) 276
AfaI GTAC 1 cut(s) 463
AfeI AGCGCT 1 cut(s) 688
AfiI CCNNNNNNNGG 8 cut(s) 233, 293, 435, 482, 652, 908, 955, 1024
AflII CTTAAG 1 cut(s) 556
AgsI TTSAA 9 cut(s) 157, 386, 578, 670, 801, 1066, 1124, 1153, 1222
AhdI GACNNNNNGTC 1 cut(s) 679
AjnI CCWGG 3 cut(s) 190, 358, 1156
AluBI AGCT 6 cut(s) 16, 98, 113, 678, 972, 1181
AluI AGCT 6 cut(s) 16, 98, 113, 678, 972, 1181
Alw26I GTCTC 2 cut(s) 817, 1209
Ama87I CYCGRG 1 cut(s) 567
Aor51HI AGCGCT 1 cut(s) 688
ApeKI GCWGC 2 cut(s) 110, 689
ApoI RAATTY 8 cut(s) 50, 391, 635, 715, 805, 1021, 1084, 1109
Asp700I GAANNNNTTC 1 cut(s) 148
AspLEI GCGC 1 cut(s) 689
AspS9I GGNCC 2 cut(s) 188, 439
AsuC2I CCSGG 1 cut(s) 483
AsuHPI GGTGA 1 cut(s) 1172
AsuII TTCGAA 1 cut(s) 166
AvaI CYCGRG 1 cut(s) 567
AvaII GGWCC 2 cut(s) 188, 439
BaeI ACNNNNGTAYC 2 cut(s) 453, 486
BamHI GGATCC 1 cut(s) 829
BbsI GAAGAC 1 cut(s) 597
BbvI GCAGC 2 cut(s) 122, 676
BccI CCATC 5 cut(s) 48, 100, 295, 733, 916
BceAI ACGGC 1 cut(s) 425
BciT130I CCWGG 3 cut(s) 192, 360, 1158
BclI TGATCA 2 cut(s) 343, 403
BcnI CCSGG 1 cut(s) 483
BcoDI GTCTC 2 cut(s) 817, 1209
BfaI CTAG 1 cut(s) 21
BfmI CTRYAG 1 cut(s) 114
BfoI RGCGCY 1 cut(s) 690
BfrI CTTAAG 1 cut(s) 556
BisI GCNGC 2 cut(s) 111, 690
BlpI GCTNAGC 1 cut(s) 879
BlsI GCNGC 2 cut(s) 112, 691
Bme1390I CCNGG 4 cut(s) 192, 360, 483, 1158
Bme18I GGWCC 2 cut(s) 188, 439
BmeRI GACNNNNNGTC 1 cut(s) 679
BmeT110I CYCGRG 1 cut(s) 567
BmgT120I GGNCC 2 cut(s) 188, 439
BmiI GGNNCC 3 cut(s) 440, 621, 831
BmrFI CCNGG 4 cut(s) 192, 360, 483, 1158
BmsI GCATC 4 cut(s) 517, 949, 978, 1148
BpiI GAAGAC 1 cut(s) 597
BpmI CTGGAG 2 cut(s) 29, 799
Bpu1102I GCTNAGC 1 cut(s) 879
Bpu14I TTCGAA 1 cut(s) 166
BpuMI CCSGG 1 cut(s) 483
BsaBI GATNNNNATC 1 cut(s) 897
BsaJI CCNNGG 2 cut(s) 191, 1005
Bsc4I CCNNNNNNNGG 8 cut(s) 233, 293, 435, 482, 652, 908, 955, 1024
Bse1I ACTGG 5 cut(s) 190, 214, 467, 601, 816
Bse3DI GCAATG 2 cut(s) 277, 1174
Bse8I GATNNNNATC 1 cut(s) 897
BseBI CCWGG 3 cut(s) 192, 360, 1158
BseDI CCNNGG 2 cut(s) 191, 1005
BseGI GGATG 5 cut(s) 243, 322, 562, 927, 964
BseJI GATNNNNATC 1 cut(s) 897
BseLI CCNNNNNNNGG 8 cut(s) 233, 293, 435, 482, 652, 908, 955, 1024
BseMI GCAATG 2 cut(s) 277, 1174
BseMII CTCAG 3 cut(s) 707, 870, 920
BseNI ACTGG 5 cut(s) 190, 214, 467, 601, 816
BseXI GCAGC 2 cut(s) 122, 676
BsiHKCI CYCGRG 1 cut(s) 567
BsiSI CCGG 1 cut(s) 483
BslFI GGGAC 2 cut(s) 452, 755
BslI CCNNNNNNNGG 8 cut(s) 233, 293, 435, 482, 652, 908, 955, 1024
BsmAI GTCTC 2 cut(s) 817, 1209
BsmFI GGGAC 2 cut(s) 452, 755
BsoBI CYCGRG 1 cut(s) 567
Bsp119I TTCGAA 1 cut(s) 166
Bsp1720I GCTNAGC 1 cut(s) 879
BspACI CCGC 2 cut(s) 436, 775
BspCNI CTCAG 3 cut(s) 706, 871, 919
BspLI GGNNCC 3 cut(s) 440, 621, 831
BspT104I TTCGAA 1 cut(s) 166
BspTI CTTAAG 1 cut(s) 556
BsrDI GCAATG 2 cut(s) 277, 1174
BsrI ACTGG 5 cut(s) 190, 214, 467, 601, 816
BssECI CCNNGG 2 cut(s) 191, 1005
Bst2UI CCWGG 3 cut(s) 192, 360, 1158
Bst4CI ACNGT 4 cut(s) 368, 416, 782, 1080
Bst6I CTCTTC 1 cut(s) 580
BstAFI CTTAAG 1 cut(s) 556
BstAPI GCANNNNNTGC 1 cut(s) 283
BstBI TTCGAA 1 cut(s) 166
BstC8I GCNNGC 3 cut(s) 37, 284, 993
BstDEI CTNAG 3 cut(s) 693, 879, 906
BstDSI CCRYGG 1 cut(s) 1005
BstF5I GGATG 5 cut(s) 243, 322, 562, 927, 964
BstH2I RGCGCY 1 cut(s) 690
BstHHI GCGC 1 cut(s) 689
BstMAI GTCTC 2 cut(s) 817, 1209
BstMWI GCNNNNNNNGC 2 cut(s) 283, 684
BstNI CCWGG 3 cut(s) 192, 360, 1158
BstSCI CCNGG 4 cut(s) 190, 358, 481, 1156
BstSFI CTRYAG 1 cut(s) 114
BstV1I GCAGC 2 cut(s) 122, 676
BstV2I GAAGAC 1 cut(s) 597
BstX2I RGATCY 3 cut(s) 218, 829, 1239
BstYI RGATCY 3 cut(s) 218, 829, 1239
BtgI CCRYGG 1 cut(s) 1005
BtsCI GGATG 5 cut(s) 243, 322, 562, 927, 964
BtsI GCAGTG 1 cut(s) 873
BtsIMutI CAGTG 4 cut(s) 207, 621, 873, 1137
Cac8I GCNNGC 3 cut(s) 37, 284, 993
CfoI GCGC 1 cut(s) 689
Cfr13I GGNCC 2 cut(s) 188, 439
CseI GACGC 1 cut(s) 506
Csp6I GTAC 1 cut(s) 462
CviAII CATG 7 cut(s) 176, 223, 314, 659, 976, 1057, 1225
CviQI GTAC 1 cut(s) 462
DdeI CTNAG 3 cut(s) 693, 879, 906
DraI TTTAAA 1 cut(s) 627
DriI GACNNNNNGTC 1 cut(s) 679
Eam1104I CTCTTC 1 cut(s) 580
Eam1105I GACNNNNNGTC 1 cut(s) 679
EarI CTCTTC 1 cut(s) 580
Eco47I GGWCC 2 cut(s) 188, 439
Eco47III AGCGCT 1 cut(s) 688
Eco57I CTGAAG 1 cut(s) 276
Eco88I CYCGRG 1 cut(s) 567
EcoO109I RGGNCCY 1 cut(s) 439
EcoRII CCWGG 3 cut(s) 190, 358, 1156
EcoT22I ATGCAT 1 cut(s) 181
FaeI CATG 7 cut(s) 179, 226, 317, 662, 979, 1060, 1228
FaqI GGGAC 2 cut(s) 452, 755
FatI CATG 7 cut(s) 175, 222, 313, 658, 975, 1056, 1224
FauI CCCGC 1 cut(s) 429
FbaI TGATCA 2 cut(s) 343, 403
Fnu4HI GCNGC 2 cut(s) 111, 690
FokI GGATG 5 cut(s) 250, 309, 549, 934, 971
Fsp4HI GCNGC 2 cut(s) 111, 690
FspBI CTAG 1 cut(s) 21
GlaI GCGC 1 cut(s) 688
GluI GCNGC 2 cut(s) 111, 690
GsuI CTGGAG 2 cut(s) 29, 799
HaeII RGCGCY 1 cut(s) 690
HapII CCGG 1 cut(s) 483
HgaI GACGC 1 cut(s) 506
HhaI GCGC 1 cut(s) 689
Hin1II CATG 7 cut(s) 179, 226, 317, 662, 979, 1060, 1228
Hin6I GCGC 1 cut(s) 687
HinP1I GCGC 1 cut(s) 687
HindIII AAGCTT 1 cut(s) 14
HinfI GANTC 5 cut(s) 72, 128, 337, 938, 1028
HpaII CCGG 1 cut(s) 483
HphI GGTGA 1 cut(s) 1172
Hpy166II GTNNAC 4 cut(s) 253, 464, 488, 598
Hpy188I TCNGA 5 cut(s) 127, 496, 634, 710, 958
Hpy188III TCNNGA 7 cut(s) 46, 294, 341, 569, 653, 1091, 1243
Hpy8I GTNNAC 4 cut(s) 253, 464, 488, 598
HpyAV CCTTC 4 cut(s) 572, 807, 867, 1205
HpyCH4III ACNGT 4 cut(s) 368, 416, 782, 1080
HpyCH4IV ACGT 1 cut(s) 1248
HpyCH4V TGCA 5 cut(s) 179, 826, 863, 1102, 1167
HpyF10VI GCNNNNNNNGC 2 cut(s) 283, 684
HpyF3I CTNAG 3 cut(s) 693, 879, 906
HpySE526I ACGT 1 cut(s) 1248
Hsp92II CATG 7 cut(s) 179, 226, 317, 662, 979, 1060, 1228
HspAI GCGC 1 cut(s) 687
Ksp22I TGATCA 2 cut(s) 343, 403
LmnI GCTCC 2 cut(s) 625, 977
Lsp1109I GCAGC 2 cut(s) 122, 676
LweI GCATC 4 cut(s) 517, 949, 978, 1148
MaeI CTAG 1 cut(s) 21
MaeII ACGT 1 cut(s) 1248
MboII GAAGA 4 cut(s) 123, 282, 597, 597
MfeI CAATTG 1 cut(s) 821
MflI RGATCY 3 cut(s) 218, 829, 1239
MlyI GAGTC 1 cut(s) 1022
MmeI TCCRAC 2 cut(s) 877, 926
MnlI CCTC 8 cut(s) 439, 452, 576, 732, 775, 1111, 1129, 1188
Mph1103I ATGCAT 1 cut(s) 181
MroXI GAANNNNTTC 1 cut(s) 148
MseI TTAA 7 cut(s) 66, 201, 231, 303, 551, 557, 626
MslI CAYNNNNRTG 1 cut(s) 957
MspA1I CMGCKG 2 cut(s) 678, 1181
MspCI CTTAAG 1 cut(s) 556
MspI CCGG 1 cut(s) 483
MspR9I CCNGG 4 cut(s) 192, 360, 483, 1158
MunI CAATTG 1 cut(s) 821
MvaI CCWGG 3 cut(s) 192, 360, 1158
MwoI GCNNNNNNNGC 2 cut(s) 283, 684
NciI CCSGG 1 cut(s) 483
NlaIII CATG 7 cut(s) 179, 226, 317, 662, 979, 1060, 1228
NlaIV GGNNCC 3 cut(s) 440, 621, 831
NsiI ATGCAT 1 cut(s) 181
NspV TTCGAA 1 cut(s) 166
PaeR7I CTCGAG 1 cut(s) 567
PdmI GAANNNNTTC 1 cut(s) 148
PfeI GAWTC 4 cut(s) 72, 128, 337, 938
PflMI CCANNNNNTGG 2 cut(s) 233, 1024
PfoI TCCNGGA 1 cut(s) 358
PkrI GCNGC 2 cut(s) 112, 691
PleI GAGTC 1 cut(s) 1022
PpsI GAGTC 1 cut(s) 1022
PpuMI RGGWCCY 1 cut(s) 439
Psp5II RGGWCCY 1 cut(s) 439
Psp6I CCWGG 3 cut(s) 190, 358, 1156
PspGI CCWGG 3 cut(s) 190, 358, 1156
PspN4I GGNNCC 3 cut(s) 440, 621, 831
PspPI GGNCC 2 cut(s) 188, 439
PspPPI RGGWCCY 1 cut(s) 439
PsuI RGATCY 3 cut(s) 218, 829, 1239
PvuII CAGCTG 2 cut(s) 678, 1181
RsaI GTAC 1 cut(s) 463
RsaNI GTAC 1 cut(s) 462
RseI CAYNNNNRTG 1 cut(s) 957
SaqAI TTAA 7 cut(s) 66, 201, 231, 303, 551, 557, 626
SatI GCNGC 2 cut(s) 111, 690
Sau96I GGNCC 2 cut(s) 188, 439
SchI GAGTC 1 cut(s) 1022
ScrFI CCNGG 4 cut(s) 192, 360, 483, 1158
SfaNI GCATC 4 cut(s) 517, 949, 978, 1148
SfcI CTRYAG 1 cut(s) 114
Sfr274I CTCGAG 1 cut(s) 567
SfuI TTCGAA 1 cut(s) 166
SinI GGWCC 2 cut(s) 188, 439
SlaI CTCGAG 1 cut(s) 567
SmiMI CAYNNNNRTG 1 cut(s) 957
SmlI CTYRAG 2 cut(s) 556, 567
SmoI CTYRAG 2 cut(s) 556, 567
SsiI CCGC 2 cut(s) 436, 775
SspI AATATT 1 cut(s) 1000
SspMI CTAG 1 cut(s) 21
StyD4I CCNGG 4 cut(s) 190, 358, 481, 1156
TaaI ACNGT 4 cut(s) 368, 416, 782, 1080
TaiI ACGT 1 cut(s) 1251
TaqI TCGA 3 cut(s) 166, 335, 568
TfiI GAWTC 4 cut(s) 72, 128, 337, 938
Tru1I TTAA 7 cut(s) 66, 201, 231, 303, 551, 557, 626
Tru9I TTAA 7 cut(s) 66, 201, 231, 303, 551, 557, 626
TscAI CASTG 4 cut(s) 214, 621, 880, 1137
TseI GCWGC 2 cut(s) 110, 689
TspDTI ATGAA 3 cut(s) 17, 992, 1160
TspGWI ACGGA 2 cut(s) 174, 421
TspRI CASTG 4 cut(s) 214, 621, 880, 1137
Van91I CCANNNNNTGG 2 cut(s) 233, 1024
Vha464I CTTAAG 1 cut(s) 556
VpaK11BI GGWCC 2 cut(s) 188, 439
XapI RAATTY 8 cut(s) 50, 391, 635, 715, 805, 1021, 1084, 1109
XcmI CCANNNNNNNNNTGG 2 cut(s) 182, 909
XhoI CTCGAG 1 cut(s) 567
XmnI GAANNNNTTC 1 cut(s) 148
XspI CTAG 1 cut(s) 21
Zsp2I ATGCAT 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.