Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8517633.1

Orthogroup ID

OG0008360

Physical Location & Seq

Genomic Coordinates Forward (+)

4464 .. 4889

Gene Structure 426 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8517633.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 426 bp

atggccatgaagctactctcaccaccctcctcttctctctcacaacccaccaggctcttctgcttacattccacctcaaccagaccaaaacccatttcagtcccaacccttctcttccaaaggaccccaaaacggttcgttttctccaagagaatggtagtcaaagcttgcgtgaaagtggaggagaagaacgttcaagaatcttctggaagtgagtgggggaaggtctctgctgtgctgtttgacatggatggagttctctgcaatagcgaagagccttctagaagggccgcagtcgaagttttcgccgaaatgggggttgagaccacggtggaggactttgttcctttcggaggaactggtaaaatttctctgatattccatggatttgatcaattgttactgcacctctctttacatttgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HAD_2 NHL Thioredoxin_8

Protein Analysis

141

Amino Acids

15.61

Weight (kDa)

8.52

Isoelectric Point (pI)

50.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008360)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G56500 AT1G56500 AT1G56500
fragaria_vesca	FvH4_6g07620 FvH4_6g07620 FvH4_6g07620 FvH4_6g07620 FvH4_6g07620
malus_domestica	MD12G1204700.v1.1
prunus_persica	Prupe.6G311900_v2.0.a1
pyrus_communis	pycom12g19260
rosa_chinensis	RchiOBHm_Chr3g0457281
rosa_laevigata	RLG00000025237
rosa_multiflora	Rmu_co8517633.1_g000003 Rmu_sc0005442.1_g000013
rosa_roxburghii	Rroxscaffold_6G00422020 Rroxscaffold_6G00422050
rosa_rugosa	Rorug03G0019600
rosa_samantha	Rh3AG079700 Rh3BG081400 Rh3CG081800 Rh3DG083400
rosa_wichuraiana	Rw3G006870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	291
AclI	AACGTT	1 cut(s)	192
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	1 cut(s)	366
AfiI	CCNNNNNNNGG	3 cut(s)	132, 315, 353
AgsI	TTSAA	1 cut(s)	197
AjnI	CCWGG	1 cut(s)	50
AjuI	GAANNNNNNNTTGG	2 cut(s)	79, 111
AluBI	AGCT	2 cut(s)	13, 167
AluI	AGCT	2 cut(s)	13, 167
Alw26I	GTCTC	2 cut(s)	232, 317
AoxI	GGCC	2 cut(s)	3, 288
ApoI	RAATTY	1 cut(s)	366
AspS9I	GGNCC	2 cut(s)	123, 288
AsuHPI	GGTGA	1 cut(s)	12
AvaII	GGWCC	1 cut(s)	123
BalI	TGGCCA	1 cut(s)	5
BccI	CCATC	1 cut(s)	245
BciT130I	CCWGG	1 cut(s)	52
BclI	TGATCA	1 cut(s)	391
BcoDI	GTCTC	2 cut(s)	232, 317
BfaI	CTAG	1 cut(s)	282
BisI	GCNGC	1 cut(s)	291
BlsI	GCNGC	1 cut(s)	292
Bme1390I	CCNGG	1 cut(s)	52
Bme18I	GGWCC	1 cut(s)	123
BmgT120I	GGNCC	2 cut(s)	123, 288
BmiI	GGNNCC	1 cut(s)	125
BmrFI	CCNGG	1 cut(s)	52
BsaI	GGTCTC	2 cut(s)	232, 317
BsaJI	CCNNGG	2 cut(s)	327, 382
Bsc4I	CCNNNNNNNGG	3 cut(s)	132, 315, 353
Bse1I	ACTGG	1 cut(s)	364
BseBI	CCWGG	1 cut(s)	52
BseDI	CCNNGG	2 cut(s)	327, 382
BseGI	GGATG	1 cut(s)	256
BseLI	CCNNNNNNNGG	3 cut(s)	132, 315, 353
BseNI	ACTGG	1 cut(s)	364
BseRI	GAGGAG	2 cut(s)	19, 197
BsgI	GTGCAG	1 cut(s)	389
BshFI	GGCC	2 cut(s)	5, 290
BslFI	GGGAC	1 cut(s)	86
BslI	CCNNNNNNNGG	3 cut(s)	132, 315, 353
BsmAI	GTCTC	2 cut(s)	232, 317
BsmFI	GGGAC	1 cut(s)	86
BsnI	GGCC	2 cut(s)	5, 290
Bso31I	GGTCTC	2 cut(s)	232, 317
Bsp143I	GATC	1 cut(s)	391
Bsp19I	CCATGG	1 cut(s)	382
BspACI	CCGC	1 cut(s)	291
BspANI	GGCC	2 cut(s)	5, 290
BspLI	GGNNCC	1 cut(s)	125
BspQI	GCTCTTC	2 cut(s)	62, 267
BspTNI	GGTCTC	2 cut(s)	232, 317
BsrI	ACTGG	1 cut(s)	364
BssECI	CCNNGG	2 cut(s)	327, 382
BssMI	GATC	1 cut(s)	391
BssT1I	CCWWGG	1 cut(s)	382
Bst2UI	CCWGG	1 cut(s)	52
Bst4CI	ACNGT	2 cut(s)	135, 331
Bst6I	CTCTTC	4 cut(s)	37, 62, 119, 267
BstC8I	GCNNGC	1 cut(s)	169
BstDSI	CCRYGG	2 cut(s)	327, 382
BstENI	CCTNNNNNAGG	1 cut(s)	351
BstF5I	GGATG	1 cut(s)	256
BstKTI	GATC	1 cut(s)	394
BstMAI	GTCTC	2 cut(s)	232, 317
BstMBI	GATC	1 cut(s)	391
BstNI	CCWGG	1 cut(s)	52
BstSCI	CCNGG	1 cut(s)	50
BstXI	CCANNNNNNTGG	1 cut(s)	154
BsuRI	GGCC	2 cut(s)	5, 290
BtgI	CCRYGG	2 cut(s)	327, 382
BtsCI	GGATG	1 cut(s)	256
Cac8I	GCNNGC	1 cut(s)	169
Cfr13I	GGNCC	2 cut(s)	123, 288
CviAII	CATG	3 cut(s)	7, 247, 383
CviJI	RGCY	6 cut(s)	5, 13, 55, 167, 277, 290
CviKI_1	RGCY	6 cut(s)	5, 13, 55, 167, 277, 290
DpnI	GATC	1 cut(s)	393
DpnII	GATC	1 cut(s)	391
EaeI	YGGCCR	1 cut(s)	3
Eam1104I	CTCTTC	4 cut(s)	37, 62, 119, 267
EarI	CTCTTC	4 cut(s)	37, 62, 119, 267
Eco130I	CCWWGG	1 cut(s)	382
Eco31I	GGTCTC	2 cut(s)	232, 317
Eco47I	GGWCC	1 cut(s)	123
EcoNI	CCTNNNNNAGG	1 cut(s)	351
EcoO109I	RGGNCCY	1 cut(s)	123
EcoRII	CCWGG	1 cut(s)	50
EcoT14I	CCWWGG	1 cut(s)	382
ErhI	CCWWGG	1 cut(s)	382
FaeI	CATG	3 cut(s)	10, 250, 386
FaiI	YATR	3 cut(s)	8, 248, 384
FaqI	GGGAC	1 cut(s)	86
FatI	CATG	3 cut(s)	6, 246, 382
FbaI	TGATCA	1 cut(s)	391
Fnu4HI	GCNGC	1 cut(s)	291
FokI	GGATG	1 cut(s)	263
Fsp4HI	GCNGC	1 cut(s)	291
FspBI	CTAG	1 cut(s)	282
GluI	GCNGC	1 cut(s)	291
HaeIII	GGCC	2 cut(s)	5, 290
Hin1II	CATG	3 cut(s)	10, 250, 386
HindIII	AAGCTT	1 cut(s)	165
HinfI	GANTC	1 cut(s)	200
HphI	GGTGA	1 cut(s)	12
Hpy188I	TCNGA	2 cut(s)	353, 375
Hpy188III	TCNNGA	3 cut(s)	197, 207, 282
HpyAV	CCTTC	4 cut(s)	119, 217, 279, 288
HpyCH4III	ACNGT	2 cut(s)	135, 331
HpyCH4IV	ACGT	1 cut(s)	192
HpyCH4V	TGCA	2 cut(s)	264, 406
HpySE526I	ACGT	1 cut(s)	192
Hsp92II	CATG	3 cut(s)	10, 250, 386
Ksp22I	TGATCA	1 cut(s)	391
Kzo9I	GATC	1 cut(s)	391
LguI	GCTCTTC	2 cut(s)	62, 267
LpnPI	CCDG	5 cut(s)	37, 64, 94, 192, 345
MaeI	CTAG	1 cut(s)	282
MaeII	ACGT	1 cut(s)	192
MaeIII	GTNAC	1 cut(s)	399
MalI	GATC	1 cut(s)	393
MboI	GATC	1 cut(s)	391
MboII	GAAGA	6 cut(s)	24, 49, 106, 195, 199, 284
MfeI	CAATTG	1 cut(s)	395
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	2 cut(s)	366, 395
MluNI	TGGCCA	1 cut(s)	5
MnlI	CCTC	7 cut(s)	37, 40, 85, 175, 328, 347, 419
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
Msp20I	TGGCCA	1 cut(s)	5
MspR9I	CCNGG	1 cut(s)	52
MunI	CAATTG	1 cut(s)	395
MvaI	CCWGG	1 cut(s)	52
NcoI	CCATGG	1 cut(s)	382
NdeII	GATC	1 cut(s)	391
NlaIII	CATG	3 cut(s)	10, 250, 386
NlaIV	GGNNCC	1 cut(s)	125
PciSI	GCTCTTC	2 cut(s)	62, 267
PfeI	GAWTC	1 cut(s)	200
PkrI	GCNGC	1 cut(s)	292
PpuMI	RGGWCCY	1 cut(s)	123
Psp1406I	AACGTT	1 cut(s)	192
Psp5II	RGGWCCY	1 cut(s)	123
Psp6I	CCWGG	1 cut(s)	50
PspGI	CCWGG	1 cut(s)	50
PspN4I	GGNNCC	1 cut(s)	125
PspPI	GGNCC	2 cut(s)	123, 288
PspPPI	RGGWCCY	1 cut(s)	123
SapI	GCTCTTC	2 cut(s)	62, 267
SatI	GCNGC	1 cut(s)	291
Sau3AI	GATC	1 cut(s)	391
Sau96I	GGNCC	2 cut(s)	123, 288
ScrFI	CCNGG	1 cut(s)	52
SetI	ASST	6 cut(s)	15, 77, 169, 195, 228, 411
SinI	GGWCC	1 cut(s)	123
Sse9I	AATT	2 cut(s)	366, 395
SsiI	CCGC	1 cut(s)	291
SspMI	CTAG	1 cut(s)	282
StyD4I	CCNGG	1 cut(s)	50
StyI	CCWWGG	1 cut(s)	382
TaaI	ACNGT	2 cut(s)	135, 331
TaiI	ACGT	1 cut(s)	195
TaqI	TCGA	1 cut(s)	297
TasI	AATT	2 cut(s)	366, 395
TauI	GCSGC	1 cut(s)	293
TfiI	GAWTC	1 cut(s)	200
TspDTI	ATGAA	1 cut(s)	23
VpaK11BI	GGWCC	1 cut(s)	123
XagI	CCTNNNNNAGG	1 cut(s)	351
XapI	RAATTY	1 cut(s)	366
XbaI	TCTAGA	1 cut(s)	281
XspI	CTAG	1 cut(s)	282

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.