Rmu_sc0000078.1_g000040

Ankyrin repeats (many copies)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000078.1
OG0017185
Physical Location & Seq
Reverse (-)
172991 .. 173590
600 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000078.1_g000040.1.cds

Sequence Viewer

Length: 600 bp
atggatatgaacgacgtcgagcaaatacccgcgccgcagccggggaagtcatcgttgtactcggagtcatcgccgtgcctgtcgctttcgtcctccgagggggagctgcaggacatgccgctggcgccgccgaagatgatgagccggaagaggctgtgcaagcagctgtccatgtgcgagacgccgcgtgacattgcatgggagaagcggcgccggcaaattctgaagcaggagaggaagaggaagaggaacggaaatggtgactcccccggcgccgccgccgaaccagagggagacgacatgaacctgaccgacgaggacttgcatgagctgaaagggtgtatagagctagggtttgggttcaacgaggaagagggtcaacggttgtgccccacattgccggctcttgacctttactttgccgttaaccgccagttctcgccgagtccgatctcctcgccgaatagcagccggcattccacgtcgtcaattggtggtgcgacgtcgtcgtttggtggactttcatcgtcgtttggaagccctagccctaggagcgacagtgatggatggaagatatgcagcccaggtatattgatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 Ank_3 Ank_4 Ank_5 DUF1685 TPR_17 TPR_8

Protein Analysis

199

Amino Acids

21.68

Weight (kDa)

5.33

Isoelectric Point (pI)

91.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017185)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G08790
fragaria_vesca FvH4_6g02671
malus_domestica MD04G1226100.v1.1 MD12G1243200.v1.1
prunus_persica Prupe.6G344900_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0450641
rosa_laevigata RLG00000025715
rosa_multiflora Rmu_sc0000078.1_g000040
rosa_rugosa Rorug02G0629200
rosa_samantha Rh3AG029900 Rh3BG030300 Rh3CG029200 Rh3DG030000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 18, 506
AccB1I GGYRCC 3 cut(s) 124, 210, 272
AccII CGCG 2 cut(s) 32, 187
AciI CCGC 9 cut(s) 30, 35, 119, 128, 185, 208, 276, 279, 430
AcsI RAATTY 1 cut(s) 219
AcuI CTGAAG 1 cut(s) 245
AcyI GRCGYC 6 cut(s) 15, 125, 182, 211, 273, 503
AfaI GTAC 1 cut(s) 59
AfiI CCNNNNNNNGG 2 cut(s) 41, 99
AgsI TTSAA 1 cut(s) 364
AjiI CACGTC 1 cut(s) 483
AjnI CCWGG 1 cut(s) 583
AluBI AGCT 4 cut(s) 106, 166, 331, 349
AluI AGCT 4 cut(s) 106, 166, 331, 349
Alw26I GTCTC 2 cut(s) 173, 288
ApeKI GCWGC 5 cut(s) 37, 106, 163, 468, 579
ApoI RAATTY 1 cut(s) 219
ArsI GACNNNNNNTTYG 2 cut(s) 401, 433
AspA2I CCTAGG 1 cut(s) 548
AspLEI GCGC 4 cut(s) 34, 127, 213, 275
AsuC2I CCSGG 2 cut(s) 42, 270
AsuHPI GGTGA 1 cut(s) 272
AvrII CCTAGG 1 cut(s) 548
BaeGI GKGCMC 1 cut(s) 392
BanI GGYRCC 3 cut(s) 124, 210, 272
BbvI GCAGC 5 cut(s) 49, 93, 175, 480, 591
BccI CCATC 2 cut(s) 557, 561
BceAI ACGGC 2 cut(s) 58, 407
BciT130I CCWGG 1 cut(s) 585
BcnI CCSGG 2 cut(s) 42, 270
BcoDI GTCTC 2 cut(s) 173, 288
BfaI CTAG 4 cut(s) 350, 543, 549, 598
BfmI CTRYAG 1 cut(s) 107
BfoI RGCGCY 3 cut(s) 128, 214, 276
BlnI CCTAGG 1 cut(s) 548
Bme1390I CCNGG 3 cut(s) 42, 270, 585
BmgBI CACGTC 1 cut(s) 483
BmiI GGNNCC 3 cut(s) 126, 212, 274
BmrFI CCNGG 3 cut(s) 42, 270, 585
BpuMI CCSGG 2 cut(s) 42, 270
BsaHI GRCGYC 6 cut(s) 15, 125, 182, 211, 273, 503
BsaJI CCNNGG 5 cut(s) 41, 96, 268, 548, 583
BsaXI ACNNNNNCTCC 2 cut(s) 544, 574
Bsc4I CCNNNNNNNGG 2 cut(s) 41, 99
Bse118I RCCGGY 3 cut(s) 213, 400, 471
Bse1I ACTGG 1 cut(s) 433
Bse3DI GCAATG 2 cut(s) 192, 395
BseBI CCWGG 1 cut(s) 585
BseDI CCNNGG 5 cut(s) 41, 96, 268, 548, 583
BseGI GGATG 1 cut(s) 572
BseLI CCNNNNNNNGG 2 cut(s) 41, 99
BseMI GCAATG 2 cut(s) 192, 395
BseNI ACTGG 1 cut(s) 433
BseRI GAGGAG 1 cut(s) 445
BseSI GKGCMC 1 cut(s) 392
BseXI GCAGC 5 cut(s) 49, 93, 175, 480, 591
Bsh1236I CGCG 2 cut(s) 32, 187
BshNI GGYRCC 3 cut(s) 124, 210, 272
BsiSI CCGG 6 cut(s) 41, 145, 214, 270, 401, 472
BslI CCNNNNNNNGG 2 cut(s) 41, 99
BsmAI GTCTC 2 cut(s) 173, 288
BsmBI CGTCTC 2 cut(s) 173, 288
BsmI GAATGC 1 cut(s) 475
Bsp1286I GDGCHC 1 cut(s) 392
Bsp143I GATC 2 cut(s) 450, 594
BspACI CCGC 9 cut(s) 30, 35, 119, 128, 185, 208, 276, 279, 430
BspFNI CGCG 2 cut(s) 32, 187
BspLI GGNNCC 3 cut(s) 126, 212, 274
BspMAI CTGCAG 1 cut(s) 111
BspT107I GGYRCC 3 cut(s) 124, 210, 272
BsrDI GCAATG 2 cut(s) 192, 395
BsrFI RCCGGY 3 cut(s) 213, 400, 471
BsrI ACTGG 1 cut(s) 433
BssAI RCCGGY 3 cut(s) 213, 400, 471
BssECI CCNNGG 5 cut(s) 41, 96, 268, 548, 583
BssMI GATC 2 cut(s) 450, 594
BssNI GRCGYC 6 cut(s) 15, 125, 182, 211, 273, 503
BssT1I CCWWGG 1 cut(s) 548
Bst2UI CCWGG 1 cut(s) 585
Bst4CI ACNGT 2 cut(s) 384, 560
Bst6I CTCTTC 4 cut(s) 143, 233, 239, 366
BstACI GRCGYC 6 cut(s) 15, 125, 182, 211, 273, 503
BstAPI GCANNNNNTGC 1 cut(s) 115
BstC8I GCNNGC 5 cut(s) 123, 161, 215, 402, 473
BstF5I GGATG 1 cut(s) 572
BstFNI CGCG 2 cut(s) 32, 187
BstH2I RGCGCY 3 cut(s) 128, 214, 276
BstHHI GCGC 4 cut(s) 34, 127, 213, 275
BstKTI GATC 2 cut(s) 453, 597
BstMAI GTCTC 2 cut(s) 173, 288
BstMBI GATC 2 cut(s) 450, 594
BstMWI GCNNNNNNNGC 6 cut(s) 115, 124, 127, 160, 214, 552
BstNI CCWGG 1 cut(s) 585
BstNSI RCATGY 1 cut(s) 118
BstSCI CCNGG 3 cut(s) 40, 268, 583
BstSFI CTRYAG 1 cut(s) 107
BstSLI GKGCMC 1 cut(s) 392
BstUI CGCG 2 cut(s) 32, 187
BstV1I GCAGC 5 cut(s) 49, 93, 175, 480, 591
BtgZI GCGATG 1 cut(s) 54
BtrI CACGTC 1 cut(s) 483
BtsCI GGATG 1 cut(s) 572
BtsIMutI CAGTG 1 cut(s) 565
Cac8I GCNNGC 5 cut(s) 123, 161, 215, 402, 473
CfoI GCGC 4 cut(s) 34, 127, 213, 275
Cfr10I RCCGGY 3 cut(s) 213, 400, 471
CseI GACGC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 58
CviAII CATG 5 cut(s) 115, 172, 198, 301, 326
CviQI GTAC 1 cut(s) 58
DinI GGCGCC 3 cut(s) 126, 212, 274
DpnI GATC 2 cut(s) 452, 596
DpnII GATC 2 cut(s) 450, 594
Eam1104I CTCTTC 4 cut(s) 143, 233, 239, 366
EarI CTCTTC 4 cut(s) 143, 233, 239, 366
Eco130I CCWWGG 1 cut(s) 548
Eco57I CTGAAG 1 cut(s) 245
EcoRII CCWGG 1 cut(s) 583
EcoT14I CCWWGG 1 cut(s) 548
EgeI GGCGCC 3 cut(s) 126, 212, 274
EheI GGCGCC 3 cut(s) 126, 212, 274
ErhI CCWWGG 1 cut(s) 548
Esp3I CGTCTC 2 cut(s) 173, 288
FaeI CATG 5 cut(s) 118, 175, 201, 304, 329
FaiI YATR 9 cut(s) 8, 116, 173, 199, 302, 327, 344, 577, 590
FatI CATG 5 cut(s) 114, 171, 197, 300, 325
FauI CCCGC 1 cut(s) 37
FokI GGATG 1 cut(s) 579
FspBI CTAG 4 cut(s) 350, 543, 549, 598
GlaI GCGC 4 cut(s) 33, 126, 212, 274
HaeII RGCGCY 3 cut(s) 128, 214, 276
HapII CCGG 6 cut(s) 41, 145, 214, 270, 401, 472
HgaI GACGC 1 cut(s) 190
HhaI GCGC 4 cut(s) 34, 127, 213, 275
Hin1I GRCGYC 6 cut(s) 15, 125, 182, 211, 273, 503
Hin1II CATG 5 cut(s) 118, 175, 201, 304, 329
Hin6I GCGC 4 cut(s) 32, 125, 211, 273
HinP1I GCGC 4 cut(s) 32, 125, 211, 273
HincII GTYRAC 2 cut(s) 380, 427
HindII GTYRAC 2 cut(s) 380, 427
HinfI GANTC 3 cut(s) 65, 263, 445
HpaI GTTAAC 1 cut(s) 427
HpaII CCGG 6 cut(s) 41, 145, 214, 270, 401, 472
HphI GGTGA 1 cut(s) 272
Hpy166II GTNNAC 3 cut(s) 380, 427, 518
Hpy188I TCNGA 4 cut(s) 64, 97, 225, 450
Hpy188III TCNNGA 1 cut(s) 407
Hpy8I GTNNAC 3 cut(s) 380, 427, 518
Hpy99I CGWCG 8 cut(s) 17, 20, 317, 487, 505, 508, 511, 532
HpyCH4III ACNGT 2 cut(s) 384, 560
HpyCH4IV ACGT 3 cut(s) 15, 482, 503
HpyCH4V TGCA 5 cut(s) 109, 159, 197, 325, 579
HpyF10VI GCNNNNNNNGC 6 cut(s) 115, 124, 127, 160, 214, 552
HpySE526I ACGT 3 cut(s) 15, 482, 503
Hsp92I GRCGYC 6 cut(s) 15, 125, 182, 211, 273, 503
Hsp92II CATG 5 cut(s) 118, 175, 201, 304, 329
HspAI GCGC 4 cut(s) 32, 125, 211, 273
KasI GGCGCC 3 cut(s) 124, 210, 272
KroI GCCGGC 3 cut(s) 213, 400, 471
KroNI GCCGGC 3 cut(s) 215, 402, 473
KspAI GTTAAC 1 cut(s) 427
Kzo9I GATC 2 cut(s) 450, 594
LmnI GCTCC 2 cut(s) 103, 552
Lsp1109I GCAGC 5 cut(s) 49, 93, 175, 480, 591
MaeI CTAG 4 cut(s) 350, 543, 549, 598
MaeII ACGT 3 cut(s) 15, 482, 503
MaeIII GTNAC 2 cut(s) 188, 260
MalI GATC 2 cut(s) 452, 596
MboI GATC 2 cut(s) 450, 594
MboII GAAGA 6 cut(s) 145, 160, 250, 256, 383, 583
MfeI CAATTG 1 cut(s) 489
MhlI GDGCHC 1 cut(s) 392
MluCI AATT 2 cut(s) 219, 489
Mly113I GGCGCC 3 cut(s) 125, 211, 273
MlyI GAGTC 3 cut(s) 74, 257, 454
MroNI GCCGGC 3 cut(s) 213, 400, 471
MseI TTAA 1 cut(s) 426
MslI CAYNNNNRTG 1 cut(s) 73
MspA1I CMGCKG 2 cut(s) 121, 166
MspI CCGG 6 cut(s) 41, 145, 214, 270, 401, 472
MspR9I CCNGG 3 cut(s) 42, 270, 585
MunI CAATTG 1 cut(s) 489
Mva1269I GAATGC 1 cut(s) 475
MvaI CCWGG 1 cut(s) 585
MvnI CGCG 2 cut(s) 32, 187
MwoI GCNNNNNNNGC 6 cut(s) 115, 124, 127, 160, 214, 552
NaeI GCCGGC 3 cut(s) 215, 402, 473
NarI GGCGCC 3 cut(s) 125, 211, 273
NciI CCSGG 2 cut(s) 42, 270
NdeII GATC 2 cut(s) 450, 594
NgoMIV GCCGGC 3 cut(s) 213, 400, 471
NlaIII CATG 5 cut(s) 118, 175, 201, 304, 329
NlaIV GGNNCC 3 cut(s) 126, 212, 274
NmeAIII GCCGAG 1 cut(s) 468
NmuCI GTSAC 2 cut(s) 188, 260
NspI RCATGY 1 cut(s) 118
PcsI WCGNNNNNNNCGW 1 cut(s) 446
PctI GAATGC 1 cut(s) 475
PdiI GCCGGC 3 cut(s) 215, 402, 473
PflFI GACNNNGTC 1 cut(s) 505
PleI GAGTC 3 cut(s) 73, 257, 453
PluTI GGCGCC 3 cut(s) 128, 214, 276
PpsI GAGTC 3 cut(s) 73, 257, 453
Psp6I CCWGG 1 cut(s) 583
PspGI CCWGG 1 cut(s) 583
PspN4I GGNNCC 3 cut(s) 126, 212, 274
PstI CTGCAG 1 cut(s) 111
PsyI GACNNNGTC 1 cut(s) 505
PvuII CAGCTG 1 cut(s) 166
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
RseI CAYNNNNRTG 1 cut(s) 73
SaqAI TTAA 1 cut(s) 426
Sau3AI GATC 2 cut(s) 450, 594
SchI GAGTC 3 cut(s) 74, 257, 454
ScrFI CCNGG 3 cut(s) 42, 270, 585
SduI GDGCHC 1 cut(s) 392
SfcI CTRYAG 1 cut(s) 107
SfoI GGCGCC 3 cut(s) 126, 212, 274
SmiMI CAYNNNNRTG 1 cut(s) 73
Sse9I AATT 2 cut(s) 219, 489
SsiI CCGC 9 cut(s) 30, 35, 119, 128, 185, 208, 276, 279, 430
SspDI GGCGCC 3 cut(s) 124, 210, 272
SspMI CTAG 4 cut(s) 350, 543, 549, 598
StyD4I CCNGG 3 cut(s) 40, 268, 583
StyI CCWWGG 1 cut(s) 548
TaaI ACNGT 2 cut(s) 384, 560
TaiI ACGT 3 cut(s) 18, 485, 506
TaqI TCGA 1 cut(s) 18
TaqII GACCGA 1 cut(s) 326
TasI AATT 2 cut(s) 219, 489
TatI WGTACW 1 cut(s) 57
TauI GCSGC 7 cut(s) 37, 121, 130, 187, 211, 278, 281
Tru1I TTAA 1 cut(s) 426
Tru9I TTAA 1 cut(s) 426
TscAI CASTG 1 cut(s) 565
TseFI GTSAC 2 cut(s) 188, 260
TseI GCWGC 5 cut(s) 37, 106, 163, 468, 579
Tsp45I GTSAC 2 cut(s) 188, 260
TspDTI ATGAA 3 cut(s) 23, 317, 513
TspGWI ACGGA 1 cut(s) 267
TspRI CASTG 1 cut(s) 565
Tth111I GACNNNGTC 1 cut(s) 505
XapI RAATTY 1 cut(s) 219
XceI RCATGY 1 cut(s) 118
XmaJI CCTAGG 1 cut(s) 548
XspI CTAG 4 cut(s) 350, 543, 549, 598
ZraI GACGTC 2 cut(s) 16, 504
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.