Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000240.1

Orthogroup ID

OG0017791

Physical Location & Seq

Genomic Coordinates Reverse (-)

279007 .. 279562

Gene Structure 556 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000240.1_g000058.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 312 bp

atgttggacattaaaggtgcagatgcaactaaagtagttctaatgactcttcattcatttgggaagggctctggtgttggggtttcctttgctggttccaagggtttctgtcagggccttttggtaactttggctattgctgttcacaatataccagaaggattagctaatccccagatggttcttaggtcatctggaattagggatggcaaaaatctccagcgaggcggagctccattggatatccgacccctaatggggggagaattcggggacaaatggggatggggatcctcaatctccgctatctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000041 GO:0003674 GO:0005215 GO:0005385 GO:0005575 GO:0006810 GO:0006811 GO:0006812 GO:0006829 GO:0008150 GO:0008324 GO:0015075 GO:0015318 GO:0016020 GO:0022857 GO:0022890 GO:0030001 GO:0034220 GO:0046873 GO:0046915 GO:0051179 GO:0051234 GO:0055085 GO:0070838 GO:0071577 GO:0072509 GO:0072511 GO:0098655 GO:0098660 GO:0098662

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Zip

Protein Analysis

103

Amino Acids

10.64

Weight (kDa)

9.43

Isoelectric Point (pI)

23.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017791)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0459981 RchiOBHm_Chr3g0460031
rosa_laevigata	RLG00000025049
rosa_multiflora	Rmu_sc0000240.1_g000058 Rmu_sc0000240.1_g000059 Rmu_sc0013658.1_g000002 Rmu_sc0016534.1_g000009
rosa_rugosa	Rorug03G0039000
rosa_samantha	Rh3BG100500 Rh3CG102300 Rh3CG102500 Rh3DG102000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	228, 303
AclWI	GGATC	2 cut(s)	285, 298
AcsI	RAATTY	1 cut(s)	266
AfiI	CCNNNNNNNGG	3 cut(s)	257, 258, 259
AluBI	AGCT	2 cut(s)	167, 233
AluI	AGCT	2 cut(s)	167, 233
Alw21I	GWGCWC	1 cut(s)	235
AlwI	GGATC	2 cut(s)	285, 298
AoxI	GGCC	1 cut(s)	115
ApoI	RAATTY	1 cut(s)	266
AspS9I	GGNCC	1 cut(s)	115
BamHI	GGATCC	1 cut(s)	290
BanII	GRGCYC	2 cut(s)	71, 235
Bbv12I	GWGCWC	1 cut(s)	235
BccI	CCATC	3 cut(s)	172, 200, 279
BmgT120I	GGNCC	1 cut(s)	115
BmiI	GGNNCC	2 cut(s)	97, 292
BmsI	GCATC	1 cut(s)	13
BpmI	CTGGAG	1 cut(s)	203
BsaBI	GATNNNNATC	1 cut(s)	289
BsaJI	CCNNGG	1 cut(s)	99
Bsc4I	CCNNNNNNNGG	3 cut(s)	257, 258, 259
Bse8I	GATNNNNATC	1 cut(s)	289
BseDI	CCNNGG	1 cut(s)	99
BseGI	GGATG	2 cut(s)	211, 290
BseJI	GATNNNNATC	1 cut(s)	289
BseLI	CCNNNNNNNGG	3 cut(s)	257, 258, 259
BsgI	GTGCAG	1 cut(s)	39
BshFI	GGCC	1 cut(s)	117
BsiHKAI	GWGCWC	1 cut(s)	235
BslFI	GGGAC	1 cut(s)	287
BslI	CCNNNNNNNGG	3 cut(s)	257, 258, 259
BsmFI	GGGAC	1 cut(s)	287
BsnI	GGCC	1 cut(s)	117
Bsp1286I	GDGCHC	2 cut(s)	71, 235
Bsp143I	GATC	1 cut(s)	290
BspACI	CCGC	2 cut(s)	228, 303
BspANI	GGCC	1 cut(s)	117
BspLI	GGNNCC	2 cut(s)	97, 292
BspPI	GGATC	2 cut(s)	285, 298
BssECI	CCNNGG	1 cut(s)	99
BssMI	GATC	1 cut(s)	290
BssT1I	CCWWGG	1 cut(s)	99
Bst6I	CTCTTC	1 cut(s)	54
BstDEI	CTNAG	1 cut(s)	185
BstF5I	GGATG	2 cut(s)	211, 290
BstKTI	GATC	1 cut(s)	293
BstMBI	GATC	1 cut(s)	290
BstX2I	RGATCY	1 cut(s)	290
BstYI	RGATCY	1 cut(s)	290
BsuRI	GGCC	1 cut(s)	117
BtsCI	GGATG	2 cut(s)	211, 290
Cfr13I	GGNCC	1 cut(s)	115
CviJI	RGCY	5 cut(s)	69, 117, 134, 167, 233
CviKI_1	RGCY	5 cut(s)	69, 117, 134, 167, 233
DdeI	CTNAG	1 cut(s)	185
DpnI	GATC	1 cut(s)	292
DpnII	GATC	1 cut(s)	290
Eam1104I	CTCTTC	1 cut(s)	54
EarI	CTCTTC	1 cut(s)	54
EciI	GGCGGA	1 cut(s)	243
Ecl136II	GAGCTC	1 cut(s)	233
Eco130I	CCWWGG	1 cut(s)	99
Eco24I	GRGCYC	2 cut(s)	71, 235
Eco32I	GATATC	1 cut(s)	244
Eco53kI	GAGCTC	1 cut(s)	233
EcoICRI	GAGCTC	1 cut(s)	233
EcoO109I	RGGNCCY	1 cut(s)	115
EcoRI	GAATTC	1 cut(s)	266
EcoRV	GATATC	1 cut(s)	244
EcoT14I	CCWWGG	1 cut(s)	99
EcoT38I	GRGCYC	2 cut(s)	71, 235
ErhI	CCWWGG	1 cut(s)	99
FaiI	YATR	1 cut(s)	152
FaqI	GGGAC	1 cut(s)	287
FokI	GGATG	2 cut(s)	218, 297
FriOI	GRGCYC	2 cut(s)	71, 235
GsuI	CTGGAG	1 cut(s)	203
HaeIII	GGCC	1 cut(s)	117
HinfI	GANTC	1 cut(s)	46
Hpy166II	GTNNAC	1 cut(s)	145
Hpy188I	TCNGA	1 cut(s)	248
Hpy188III	TCNNGA	1 cut(s)	195
Hpy8I	GTNNAC	1 cut(s)	145
HpyAV	CCTTC	2 cut(s)	58, 152
HpyCH4V	TGCA	2 cut(s)	20, 26
HpyF3I	CTNAG	1 cut(s)	185
Kzo9I	GATC	1 cut(s)	290
LmnI	GCTCC	2 cut(s)	230, 238
LpnPI	CCDG	7 cut(s)	57, 78, 98, 168, 180, 188, 233
LweI	GCATC	1 cut(s)	13
MaeIII	GTNAC	1 cut(s)	124
MalI	GATC	1 cut(s)	292
MboI	GATC	1 cut(s)	290
MboII	GAAGA	1 cut(s)	41
MflI	RGATCY	1 cut(s)	290
MhlI	GDGCHC	2 cut(s)	71, 235
MluCI	AATT	2 cut(s)	198, 266
MlyI	GAGTC	1 cut(s)	40
MmeI	TCCRAC	1 cut(s)	271
MnlI	CCTC	2 cut(s)	218, 304
MseI	TTAA	1 cut(s)	12
NdeII	GATC	1 cut(s)	290
NlaIV	GGNNCC	2 cut(s)	97, 292
PleI	GAGTC	1 cut(s)	40
PpsI	GAGTC	1 cut(s)	40
Psp124BI	GAGCTC	1 cut(s)	235
PspN4I	GGNNCC	2 cut(s)	97, 292
PspPI	GGNCC	1 cut(s)	115
PsuI	RGATCY	1 cut(s)	290
SacI	GAGCTC	1 cut(s)	235
SaqAI	TTAA	1 cut(s)	12
Sau3AI	GATC	1 cut(s)	290
Sau96I	GGNCC	1 cut(s)	115
SchI	GAGTC	1 cut(s)	40
SduI	GDGCHC	2 cut(s)	71, 235
SetI	ASST	4 cut(s)	19, 169, 191, 235
SfaNI	GCATC	1 cut(s)	13
Sse9I	AATT	2 cut(s)	198, 266
SsiI	CCGC	2 cut(s)	228, 303
SstI	GAGCTC	1 cut(s)	235
StyI	CCWWGG	1 cut(s)	99
TasI	AATT	2 cut(s)	198, 266
Tru1I	TTAA	1 cut(s)	12
Tru9I	TTAA	1 cut(s)	12
TspDTI	ATGAA	2 cut(s)	41, 45
XapI	RAATTY	1 cut(s)	266

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.