Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0016534.1

Orthogroup ID

OG0017791

Physical Location & Seq

Genomic Coordinates Reverse (-)

32809 .. 33327

Gene Structure 519 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0016534.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 519 bp

atgaagtctgcttgcaggaaagctttgttgttttcactcctctgcgtggttctatttgggtatgctacagccgagtctgaagaagaggtttcacggaggttgatatctgctccgcacaagaatgtgagaaccaatgttattgatggcactggtaatgagaattccttaggttttgaggatataaataatgggatcggtgagacaaagggcgggaacagcaaagtctcaatctccactgttgcattatttacgctggcaatggctgccactggtttaggtgcagtgccattcttctttgtggagcttgatccgcaatgggctggactctgcaatggaatggctgctggtgtgatgttggctgcaagctttgatcttatacagaaagggcaaggtcatggagctgggaattgggtgggctttgggattctagctgcgggaatttttattttgctttgcaagaaggtattggcttttccttatcttctgtctttacatatctgccccgtccttgacatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000041 GO:0003674 GO:0005215 GO:0005385 GO:0005575 GO:0006810 GO:0006811 GO:0006812 GO:0006829 GO:0008150 GO:0008324 GO:0015075 GO:0015318 GO:0016020 GO:0022857 GO:0022890 GO:0030001 GO:0034220 GO:0046873 GO:0046915 GO:0051179 GO:0051234 GO:0055085 GO:0070838 GO:0071577 GO:0072509 GO:0072511 GO:0098655 GO:0098660 GO:0098662

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Zip

Protein Analysis

172

Amino Acids

18.12

Weight (kDa)

6.27

Isoelectric Point (pI)

27.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017791)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0459981 RchiOBHm_Chr3g0460031
rosa_laevigata	RLG00000025049
rosa_multiflora	Rmu_sc0000240.1_g000058 Rmu_sc0000240.1_g000059 Rmu_sc0013658.1_g000002 Rmu_sc0016534.1_g000009
rosa_rugosa	Rorug03G0039000
rosa_samantha	Rh3BG100500 Rh3CG102300 Rh3CG102500 Rh3DG102000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	4 cut(s)	113, 210, 311, 434
AclWI	GGATC	2 cut(s)	200, 302
AcsI	RAATTY	2 cut(s)	160, 438
AcuI	CTGAAG	1 cut(s)	99
AfiI	CCNNNNNNNGG	1 cut(s)	46
AluBI	AGCT	5 cut(s)	23, 304, 366, 401, 431
AluI	AGCT	5 cut(s)	23, 304, 366, 401, 431
Alw26I	GTCTC	2 cut(s)	194, 229
AlwI	GGATC	2 cut(s)	200, 302
ApeKI	GCWGC	4 cut(s)	263, 341, 359, 431
ApoI	RAATTY	2 cut(s)	160, 438
AsuHPI	GGTGA	1 cut(s)	209
AxyI	CCTNAGG	1 cut(s)	166
BbvI	GCAGC	4 cut(s)	250, 328, 346, 418
BccI	CCATC	1 cut(s)	137
BcoDI	GTCTC	2 cut(s)	194, 229
BfaI	CTAG	1 cut(s)	428
BfmI	CTRYAG	1 cut(s)	66
BisI	GCNGC	4 cut(s)	264, 342, 360, 432
BlsI	GCNGC	4 cut(s)	265, 343, 361, 433
Bsc4I	CCNNNNNNNGG	1 cut(s)	46
Bse1I	ACTGG	2 cut(s)	154, 274
Bse21I	CCTNAGG	1 cut(s)	166
Bse3DI	GCAATG	3 cut(s)	264, 320, 337
BseLI	CCNNNNNNNGG	1 cut(s)	46
BseMI	GCAATG	3 cut(s)	264, 320, 337
BseNI	ACTGG	2 cut(s)	154, 274
BseRI	GAGGAG	1 cut(s)	29
BseXI	GCAGC	4 cut(s)	250, 328, 346, 418
BseYI	CCCAGC	1 cut(s)	401
BsgI	GTGCAG	1 cut(s)	300
BslI	CCNNNNNNNGG	1 cut(s)	46
BsmAI	GTCTC	2 cut(s)	194, 229
Bsp143I	GATC	3 cut(s)	192, 307, 370
BspACI	CCGC	4 cut(s)	113, 210, 311, 434
BspPI	GGATC	2 cut(s)	200, 302
BsrDI	GCAATG	3 cut(s)	264, 320, 337
BsrI	ACTGG	2 cut(s)	154, 274
BssMI	GATC	3 cut(s)	192, 307, 370
Bst4CI	ACNGT	1 cut(s)	238
Bst6I	CTCTTC	1 cut(s)	78
BstAPI	GCANNNNNTGC	1 cut(s)	263
BstC8I	GCNNGC	3 cut(s)	13, 255, 364
BstDEI	CTNAG	1 cut(s)	166
BstKTI	GATC	3 cut(s)	195, 310, 373
BstMAI	GTCTC	2 cut(s)	194, 229
BstMBI	GATC	3 cut(s)	192, 307, 370
BstMWI	GCNNNNNNNGC	3 cut(s)	216, 263, 310
BstSFI	CTRYAG	1 cut(s)	66
BstV1I	GCAGC	4 cut(s)	250, 328, 346, 418
Bsu36I	CCTNAGG	1 cut(s)	166
BtsI	GCAGTG	1 cut(s)	288
BtsIMutI	CAGTG	4 cut(s)	147, 234, 267, 288
Cac8I	GCNNGC	3 cut(s)	13, 255, 364
CviAII	CATG	1 cut(s)	395
DdeI	CTNAG	1 cut(s)	166
DpnI	GATC	3 cut(s)	194, 309, 372
DpnII	GATC	3 cut(s)	192, 307, 370
Eam1104I	CTCTTC	1 cut(s)	78
EarI	CTCTTC	1 cut(s)	78
Eco32I	GATATC	1 cut(s)	105
Eco57I	CTGAAG	1 cut(s)	99
Eco81I	CCTNAGG	1 cut(s)	166
EcoRI	GAATTC	1 cut(s)	160
EcoRV	GATATC	1 cut(s)	105
FaeI	CATG	1 cut(s)	398
FaiI	YATR	5 cut(s)	63, 182, 377, 396, 495
FatI	CATG	1 cut(s)	394
FauI	CCCGC	2 cut(s)	203, 427
Fnu4HI	GCNGC	4 cut(s)	264, 342, 360, 432
Fsp4HI	GCNGC	4 cut(s)	264, 342, 360, 432
FspBI	CTAG	1 cut(s)	428
GluI	GCNGC	4 cut(s)	264, 342, 360, 432
GsaI	CCCAGC	1 cut(s)	405
Hin1II	CATG	1 cut(s)	398
HindIII	AAGCTT	2 cut(s)	21, 364
HinfI	GANTC	3 cut(s)	74, 324, 424
HphI	GGTGA	1 cut(s)	209
Hpy188I	TCNGA	1 cut(s)	79
HpyAV	CCTTC	1 cut(s)	454
HpyCH4III	ACNGT	1 cut(s)	238
HpyCH4V	TGCA	6 cut(s)	15, 242, 281, 330, 362, 456
HpyF10VI	GCNNNNNNNGC	3 cut(s)	216, 263, 310
HpyF3I	CTNAG	1 cut(s)	166
Hsp92II	CATG	1 cut(s)	398
Kzo9I	GATC	3 cut(s)	192, 307, 370
LmnI	GCTCC	3 cut(s)	115, 301, 398
LpnPI	CCDG	6 cut(s)	135, 239, 255, 306, 330, 387
Lsp1109I	GCAGC	4 cut(s)	250, 328, 346, 418
MaeI	CTAG	1 cut(s)	428
MalI	GATC	3 cut(s)	194, 309, 372
MboI	GATC	3 cut(s)	192, 307, 370
MboII	GAAGA	4 cut(s)	92, 95, 283, 473
MluCI	AATT	3 cut(s)	160, 406, 438
MlyI	GAGTC	2 cut(s)	83, 318
MnlI	CCTC	4 cut(s)	50, 79, 90, 169
MslI	CAYNNNNRTG	1 cut(s)	120
MwoI	GCNNNNNNNGC	3 cut(s)	216, 263, 310
NdeII	GATC	3 cut(s)	192, 307, 370
NlaIII	CATG	1 cut(s)	398
NmeAIII	GCCGAG	1 cut(s)	97
PfeI	GAWTC	1 cut(s)	424
PkrI	GCNGC	4 cut(s)	265, 343, 361, 433
PleI	GAGTC	2 cut(s)	82, 318
PpsI	GAGTC	2 cut(s)	82, 318
PspFI	CCCAGC	1 cut(s)	401
RseI	CAYNNNNRTG	1 cut(s)	120
SatI	GCNGC	4 cut(s)	264, 342, 360, 432
Sau3AI	GATC	3 cut(s)	192, 307, 370
SchI	GAGTC	2 cut(s)	83, 318
SfcI	CTRYAG	1 cut(s)	66
SmiMI	CAYNNNNRTG	1 cut(s)	120
Sse9I	AATT	3 cut(s)	160, 406, 438
SsiI	CCGC	4 cut(s)	113, 210, 311, 434
SspMI	CTAG	1 cut(s)	428
TaaI	ACNGT	1 cut(s)	238
TasI	AATT	3 cut(s)	160, 406, 438
TfiI	GAWTC	1 cut(s)	424
TscAI	CASTG	4 cut(s)	154, 241, 274, 288
TseI	GCWGC	4 cut(s)	263, 341, 359, 431
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	109
TspRI	CASTG	4 cut(s)	154, 241, 274, 288
XapI	RAATTY	2 cut(s)	160, 438
XspI	CTAG	1 cut(s)	428

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.