Rmu_sc0000247.1_g000078

calcium-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000247.1
Physical Location & Seq
Reverse (-)
400103 .. 400510
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000247.1_g000078.1.cds

Sequence Viewer

Length: 408 bp
atgatggccacagtactagagcatcacatcaataacgccgcagttgagttcgtggactactttccttccatgattctgcggctcggagaagaagcgttcatcgcagagctgtgcagcgggtttcggctgctgatggatgtggagaaagggctcatcacgttcgaaagcttgaagcggaacagcctcttgctggggattcatgacatgggggacgatgagcttgtgtggatgttgatggaaggtgatctcgatggagacggggctctcagccagttggagttttgcattctcatgtttaggttaagtccaggtctaatggatgcaggacctaataagcaggtttggatggaggacattgatcgtcgtcgtcgtcatgtaaatgatcagatacatgtagggtttcaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.44

Weight (kDa)

4.61

Isoelectric Point (pI)

51.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015574)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 328
AciI CCGC 4 cut(s) 39, 79, 117, 175
AcoI YGGCCR 1 cut(s) 6
AfaI GTAC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 190
AflIII ACRYGT 1 cut(s) 391
AgsI TTSAA 2 cut(s) 172, 404
AjnI CCWGG 1 cut(s) 307
AluBI AGCT 3 cut(s) 109, 168, 220
AluI AGCT 3 cut(s) 109, 168, 220
Alw26I GTCTC 1 cut(s) 249
AoxI GGCC 1 cut(s) 6
ApeKI GCWGC 2 cut(s) 114, 127
AspS9I GGNCC 1 cut(s) 326
AsuHPI GGTGA 1 cut(s) 254
AsuII TTCGAA 1 cut(s) 162
AvaII GGWCC 1 cut(s) 326
BalI TGGCCA 1 cut(s) 8
BanII GRGCYC 2 cut(s) 153, 265
BbvI GCAGC 2 cut(s) 114, 126
BccI CCATC 4 cut(s) 127, 229, 245, 340
BciT130I CCWGG 1 cut(s) 309
BclI TGATCA 1 cut(s) 382
BcoDI GTCTC 1 cut(s) 249
BfaI CTAG 1 cut(s) 17
BfuAI ACCTGC 1 cut(s) 328
BisI GCNGC 4 cut(s) 39, 80, 115, 128
BlsI GCNGC 4 cut(s) 40, 81, 116, 129
BmcAI AGTACT 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 309
Bme18I GGWCC 1 cut(s) 326
BmgT120I GGNCC 1 cut(s) 326
BmrFI CCNGG 1 cut(s) 309
BmsI GCATC 2 cut(s) 31, 310
Bpu14I TTCGAA 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 190
Bse1I ACTGG 1 cut(s) 271
BseBI CCWGG 1 cut(s) 309
BseGI GGATG 4 cut(s) 142, 234, 325, 351
BseLI CCNNNNNNNGG 1 cut(s) 190
BseMII CTCAG 1 cut(s) 280
BseNI ACTGG 1 cut(s) 271
BseXI GCAGC 2 cut(s) 114, 126
BseYI CCCAGC 1 cut(s) 190
BsgI GTGCAG 1 cut(s) 133
BshFI GGCC 1 cut(s) 8
BslFI GGGAC 1 cut(s) 224
BslI CCNNNNNNNGG 1 cut(s) 190
BsmAI GTCTC 1 cut(s) 249
BsmBI CGTCTC 1 cut(s) 249
BsmFI GGGAC 1 cut(s) 224
BsmI GAATGC 1 cut(s) 285
BsnI GGCC 1 cut(s) 8
Bsp119I TTCGAA 1 cut(s) 162
Bsp1286I GDGCHC 2 cut(s) 153, 265
Bsp143I GATC 3 cut(s) 244, 358, 382
BspACI CCGC 4 cut(s) 39, 79, 117, 175
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 279
BspHI TCATGA 1 cut(s) 199
BspMI ACCTGC 1 cut(s) 328
BspT104I TTCGAA 1 cut(s) 162
BsrI ACTGG 1 cut(s) 271
BssMI GATC 3 cut(s) 244, 358, 382
Bst2UI CCWGG 1 cut(s) 309
Bst4CI ACNGT 1 cut(s) 13
BstBI TTCGAA 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 266
BstF5I GGATG 4 cut(s) 142, 234, 325, 351
BstKTI GATC 3 cut(s) 247, 361, 385
BstMAI GTCTC 1 cut(s) 249
BstMBI GATC 3 cut(s) 244, 358, 382
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNI CCWGG 1 cut(s) 309
BstNSI RCATGY 1 cut(s) 395
BstSCI CCNGG 1 cut(s) 307
BstV1I GCAGC 2 cut(s) 114, 126
BsuRI GGCC 1 cut(s) 8
BtgZI GCGATG 1 cut(s) 85
BtsCI GGATG 4 cut(s) 142, 234, 325, 351
BveI ACCTGC 1 cut(s) 328
CciI TCATGA 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 326
Csp6I GTAC 1 cut(s) 14
CviAII CATG 6 cut(s) 70, 200, 205, 292, 374, 392
CviQI GTAC 1 cut(s) 14
DdeI CTNAG 1 cut(s) 266
DpnI GATC 3 cut(s) 246, 360, 384
DpnII GATC 3 cut(s) 244, 358, 382
EaeI YGGCCR 1 cut(s) 6
Eco24I GRGCYC 2 cut(s) 153, 265
Eco47I GGWCC 1 cut(s) 326
EcoO109I RGGNCCY 1 cut(s) 326
EcoRII CCWGG 1 cut(s) 307
EcoT38I GRGCYC 2 cut(s) 153, 265
Esp3I CGTCTC 1 cut(s) 249
FaeI CATG 6 cut(s) 73, 203, 208, 295, 377, 395
FaiI YATR 6 cut(s) 71, 201, 206, 293, 375, 393
FaqI GGGAC 1 cut(s) 224
FatI CATG 6 cut(s) 69, 199, 204, 291, 373, 391
FauI CCCGC 1 cut(s) 110
FbaI TGATCA 1 cut(s) 382
Fnu4HI GCNGC 4 cut(s) 39, 80, 115, 128
FokI GGATG 4 cut(s) 149, 241, 332, 358
FriOI GRGCYC 2 cut(s) 153, 265
Fsp4HI GCNGC 4 cut(s) 39, 80, 115, 128
FspBI CTAG 1 cut(s) 17
GluI GCNGC 4 cut(s) 39, 80, 115, 128
GsaI CCCAGC 1 cut(s) 194
HaeIII GGCC 1 cut(s) 8
Hin1II CATG 6 cut(s) 73, 203, 208, 295, 377, 395
HindIII AAGCTT 1 cut(s) 166
HinfI GANTC 2 cut(s) 73, 196
HphI GGTGA 1 cut(s) 254
Hpy166II GTNNAC 1 cut(s) 55
Hpy188I TCNGA 2 cut(s) 86, 387
Hpy188III TCNNGA 2 cut(s) 200, 248
Hpy8I GTNNAC 1 cut(s) 55
Hpy99I CGWCG 3 cut(s) 366, 369, 372
HpyAV CCTTC 2 cut(s) 75, 233
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 158
HpyCH4V TGCA 3 cut(s) 114, 285, 323
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 266
HpySE526I ACGT 1 cut(s) 158
Hsp92II CATG 6 cut(s) 73, 203, 208, 295, 377, 395
Ksp22I TGATCA 1 cut(s) 382
Kzo9I GATC 3 cut(s) 244, 358, 382
LpnPI CCDG 6 cut(s) 176, 284, 294, 309, 321, 323
Lsp1109I GCAGC 2 cut(s) 114, 126
LweI GCATC 2 cut(s) 31, 310
MaeI CTAG 1 cut(s) 17
MaeII ACGT 1 cut(s) 158
MalI GATC 3 cut(s) 246, 360, 384
MboI GATC 3 cut(s) 244, 358, 382
MboII GAAGA 1 cut(s) 101
MhlI GDGCHC 2 cut(s) 153, 265
MlsI TGGCCA 1 cut(s) 8
MluNI TGGCCA 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 255
MnlI CCTC 2 cut(s) 194, 343
Mox20I TGGCCA 1 cut(s) 8
MscI TGGCCA 1 cut(s) 8
MseI TTAA 1 cut(s) 302
MslI CAYNNNNRTG 2 cut(s) 290, 378
Msp20I TGGCCA 1 cut(s) 8
MspA1I CMGCKG 1 cut(s) 117
MspR9I CCNGG 1 cut(s) 309
Mva1269I GAATGC 1 cut(s) 285
MvaI CCWGG 1 cut(s) 309
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 3 cut(s) 244, 358, 382
NlaIII CATG 6 cut(s) 73, 203, 208, 295, 377, 395
NspI RCATGY 1 cut(s) 395
NspV TTCGAA 1 cut(s) 162
PagI TCATGA 1 cut(s) 199
PciI ACATGT 1 cut(s) 391
PcsI WCGNNNNNNNCGW 1 cut(s) 367
PctI GAATGC 1 cut(s) 285
PfeI GAWTC 2 cut(s) 73, 196
PkrI GCNGC 4 cut(s) 40, 81, 116, 129
PpuMI RGGWCCY 1 cut(s) 326
PscI ACATGT 1 cut(s) 391
Psp5II RGGWCCY 1 cut(s) 326
Psp6I CCWGG 1 cut(s) 307
PspFI CCCAGC 1 cut(s) 190
PspGI CCWGG 1 cut(s) 307
PspPI GGNCC 1 cut(s) 326
PspPPI RGGWCCY 1 cut(s) 326
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
RseI CAYNNNNRTG 2 cut(s) 290, 378
SaqAI TTAA 1 cut(s) 302
SatI GCNGC 4 cut(s) 39, 80, 115, 128
Sau3AI GATC 3 cut(s) 244, 358, 382
Sau96I GGNCC 1 cut(s) 326
ScaI AGTACT 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 309
SduI GDGCHC 2 cut(s) 153, 265
SetI ASST 9 cut(s) 111, 161, 170, 222, 244, 302, 313, 331, 342
SfaNI GCATC 2 cut(s) 31, 310
SfuI TTCGAA 1 cut(s) 162
SinI GGWCC 1 cut(s) 326
SmiMI CAYNNNNRTG 2 cut(s) 290, 378
SsiI CCGC 4 cut(s) 39, 79, 117, 175
SspMI CTAG 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 307
TaaI ACNGT 1 cut(s) 13
TaiI ACGT 1 cut(s) 161
TaqI TCGA 2 cut(s) 162, 249
TatI WGTACW 1 cut(s) 13
TauI GCSGC 2 cut(s) 41, 82
TfiI GAWTC 2 cut(s) 73, 196
Tru1I TTAA 1 cut(s) 302
Tru9I TTAA 1 cut(s) 302
TseI GCWGC 2 cut(s) 114, 127
TspDTI ATGAA 2 cut(s) 88, 188
VpaK11BI GGWCC 1 cut(s) 326
XceI RCATGY 1 cut(s) 395
XspI CTAG 1 cut(s) 17
ZrmI AGTACT 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.