Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000366.1

Orthogroup ID

OG0017816

Physical Location & Seq

Genomic Coordinates Reverse (-)

84391 .. 85055

Gene Structure 665 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000366.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

atggcgagcaggtactgggtggtgtctctgcctgtccaaaactcaacgtcgtatttatggaaccacctccaggatcaaatctccaagcattccttcgacactcccctctacagagtaactagtttccaagatctgactacccattccctcccctttcttgtttgttttgttaaatattgtttcattattcttgcagttcaatattcccaatctcttctctccctcagcgacgatctcttaaagtccaacaactttgtagagggtgtttctcacaagatcaggtgtcagatcaaggagctagagagggtttcaggagtcaagagcagttctctcacggtggatggagttccagtggattcatacctgactaggtttgtctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000221 GO:0000325 GO:0000902 GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0005794 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0008150 GO:0008324 GO:0008553 GO:0009507 GO:0009536 GO:0009653 GO:0009826 GO:0009987 GO:0012505 GO:0015075 GO:0015077 GO:0015078 GO:0015318 GO:0015399 GO:0015405 GO:0015662 GO:0015672 GO:0016020 GO:0016043 GO:0016049 GO:0016462 GO:0016469 GO:0016471 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019829 GO:0022804 GO:0022853 GO:0022857 GO:0022890 GO:0031090 GO:0032502 GO:0032989 GO:0032991 GO:0033176 GO:0033178 GO:0033180 GO:0034220 GO:0036442 GO:0040007 GO:0042623 GO:0042625 GO:0042626 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043492 GO:0044422 GO:0044424 GO:0044425 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0048589 GO:0048856 GO:0048869 GO:0051179 GO:0051234 GO:0055085 GO:0060560 GO:0071840 GO:0071944 GO:0090662 GO:0098588 GO:0098655 GO:0098660 GO:0098662 GO:0098796 GO:0098805 GO:0099131 GO:0099132 GO:1902600

KEGG Pathways

Metabolic & Signaling

ko00190 ko01100 ko04145 ko04150 ko04721 ko04966 ko05110 ko05120 ko05323 map00190 map01100 map04145 map04150 map04721 map04966 map05110 map05120 map05323

Pfam Domains

Protein Families

V-ATPase_C

Protein Analysis

126

Amino Acids

14.41

Weight (kDa)

7.74

Isoelectric Point (pI)

31.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017816)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0048981
rosa_multiflora	Rmu_sc0000366.1_g000016 Rmu_sc0000493.1_g000050 Rmu_sc0001891.1_g000049
rosa_roxburghii	Rroxscaffold_1G00032640 Rroxscaffold_6G00389340 Rroxscaffold_6G00417960
rosa_samantha	Rh1AG159500 Rh1CG148700 Rh5BG332100 Rh5CG428800 Rh5DG343900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	81
AfaI	GTAC	1 cut(s)	14
AfiI	CCNNNNNNNGG	1 cut(s)	70
AgsI	TTSAA	1 cut(s)	200
AhlI	ACTAGT	1 cut(s)	119
AjnI	CCWGG	1 cut(s)	69
AjuI	GAANNNNNNNTTGG	2 cut(s)	77, 109
AluBI	AGCT	1 cut(s)	298
AluI	AGCT	1 cut(s)	298
Alw26I	GTCTC	1 cut(s)	30
AlwI	GGATC	1 cut(s)	81
AlwNI	CAGNNNCTG	1 cut(s)	15
BbvCI	CCTCAGC	1 cut(s)	224
BccI	CCATC	1 cut(s)	335
BciT130I	CCWGG	1 cut(s)	71
BcoDI	GTCTC	1 cut(s)	30
BcuI	ACTAGT	1 cut(s)	119
BfaI	CTAG	4 cut(s)	120, 299, 369, 379
BfmI	CTRYAG	1 cut(s)	109
BglII	AGATCT	1 cut(s)	130
Bme1390I	CCNGG	1 cut(s)	71
BmiI	GGNNCC	1 cut(s)	62
BmrFI	CCNGG	1 cut(s)	71
BmrI	ACTGGG	1 cut(s)	25
BmuI	ACTGGG	1 cut(s)	25
BplI	GAGNNNNNCTC	2 cut(s)	313, 345
BpmI	CTGGAG	1 cut(s)	53
Bpu10I	CCTNAGC	1 cut(s)	224
BsaXI	ACNNNNNCTCC	2 cut(s)	336, 366
Bsc4I	CCNNNNNNNGG	1 cut(s)	70
Bse1I	ACTGG	2 cut(s)	20, 350
BseBI	CCWGG	1 cut(s)	71
BseGI	GGATG	1 cut(s)	346
BseLI	CCNNNNNNNGG	1 cut(s)	70
BseMII	CTCAG	1 cut(s)	238
BseNI	ACTGG	2 cut(s)	20, 350
BslI	CCNNNNNNNGG	1 cut(s)	70
BsmAI	GTCTC	1 cut(s)	30
BsmI	GAATGC	1 cut(s)	88
Bsp143I	GATC	5 cut(s)	73, 130, 232, 276, 288
BspCNI	CTCAG	1 cut(s)	237
BspLI	GGNNCC	1 cut(s)	62
BspPI	GGATC	1 cut(s)	81
BsrI	ACTGG	2 cut(s)	20, 350
BssMI	GATC	5 cut(s)	73, 130, 232, 276, 288
Bst2UI	CCWGG	1 cut(s)	71
Bst4CI	ACNGT	1 cut(s)	337
Bst6I	CTCTTC	1 cut(s)	219
BstC8I	GCNNGC	1 cut(s)	7
BstDEI	CTNAG	1 cut(s)	224
BstF5I	GGATG	1 cut(s)	346
BstKTI	GATC	5 cut(s)	76, 133, 235, 279, 291
BstMAI	GTCTC	1 cut(s)	30
BstMBI	GATC	5 cut(s)	73, 130, 232, 276, 288
BstNI	CCWGG	1 cut(s)	71
BstSCI	CCNGG	1 cut(s)	69
BstSFI	CTRYAG	1 cut(s)	109
BstX2I	RGATCY	1 cut(s)	130
BstYI	RGATCY	1 cut(s)	130
BtsCI	GGATG	1 cut(s)	346
BtsIMutI	CAGTG	1 cut(s)	357
Cac8I	GCNNGC	1 cut(s)	7
CaiI	CAGNNNCTG	1 cut(s)	15
Csp6I	GTAC	1 cut(s)	13
CviJI	RGCY	1 cut(s)	298
CviKI_1	RGCY	1 cut(s)	298
CviQI	GTAC	1 cut(s)	13
DdeI	CTNAG	1 cut(s)	224
DpnI	GATC	5 cut(s)	75, 132, 234, 278, 290
DpnII	GATC	5 cut(s)	73, 130, 232, 276, 288
Eam1104I	CTCTTC	1 cut(s)	219
EarI	CTCTTC	1 cut(s)	219
EcoRII	CCWGG	1 cut(s)	69
FaiI	YATR	2 cut(s)	58, 361
FalI	AAGNNNNNCTT	2 cut(s)	77, 109
FokI	GGATG	1 cut(s)	353
FspBI	CTAG	4 cut(s)	120, 299, 369, 379
GsuI	CTGGAG	1 cut(s)	53
HinfI	GANTC	2 cut(s)	315, 356
Hpy188I	TCNGA	2 cut(s)	135, 288
Hpy188III	TCNNGA	2 cut(s)	312, 319
Hpy99I	CGWCG	2 cut(s)	52, 233
HpyAV	CCTTC	1 cut(s)	103
HpyCH4III	ACNGT	1 cut(s)	337
HpyCH4IV	ACGT	1 cut(s)	47
HpyCH4V	TGCA	1 cut(s)	194
HpyF3I	CTNAG	1 cut(s)	224
HpySE526I	ACGT	1 cut(s)	47
Kzo9I	GATC	5 cut(s)	73, 130, 232, 276, 288
LmnI	GCTCC	1 cut(s)	295
LpnPI	CCDG	7 cut(s)	45, 56, 83, 265, 297, 363, 377
MaeI	CTAG	4 cut(s)	120, 299, 369, 379
MaeII	ACGT	1 cut(s)	47
MaeIII	GTNAC	1 cut(s)	115
MalI	GATC	5 cut(s)	75, 132, 234, 278, 290
MboI	GATC	5 cut(s)	73, 130, 232, 276, 288
MboII	GAAGA	1 cut(s)	206
MflI	RGATCY	1 cut(s)	130
MlyI	GAGTC	1 cut(s)	324
MmeI	TCCRAC	1 cut(s)	270
MnlI	CCTC	6 cut(s)	77, 116, 158, 233, 253, 297
MseI	TTAA	2 cut(s)	171, 239
MspR9I	CCNGG	1 cut(s)	71
Mva1269I	GAATGC	1 cut(s)	88
MvaI	CCWGG	1 cut(s)	71
NdeII	GATC	5 cut(s)	73, 130, 232, 276, 288
NlaIV	GGNNCC	1 cut(s)	62
PctI	GAATGC	1 cut(s)	88
PfeI	GAWTC	1 cut(s)	356
PfoI	TCCNGGA	1 cut(s)	69
PleI	GAGTC	1 cut(s)	323
PpsI	GAGTC	1 cut(s)	323
Psp6I	CCWGG	1 cut(s)	69
PspGI	CCWGG	1 cut(s)	69
PspN4I	GGNNCC	1 cut(s)	62
PstNI	CAGNNNCTG	1 cut(s)	15
PsuI	RGATCY	1 cut(s)	130
RsaI	GTAC	1 cut(s)	14
RsaNI	GTAC	1 cut(s)	13
SaqAI	TTAA	2 cut(s)	171, 239
Sau3AI	GATC	5 cut(s)	73, 130, 232, 276, 288
SchI	GAGTC	1 cut(s)	324
ScrFI	CCNGG	1 cut(s)	71
SetI	ASST	7 cut(s)	14, 50, 69, 284, 300, 366, 374
SfcI	CTRYAG	1 cut(s)	109
SpeI	ACTAGT	1 cut(s)	119
SspI	AATATT	2 cut(s)	176, 203
SspMI	CTAG	4 cut(s)	120, 299, 369, 379
StyD4I	CCNGG	1 cut(s)	69
TaaI	ACNGT	1 cut(s)	337
TaiI	ACGT	1 cut(s)	50
TaqI	TCGA	1 cut(s)	96
TfiI	GAWTC	1 cut(s)	356
Tru1I	TTAA	2 cut(s)	171, 239
Tru9I	TTAA	2 cut(s)	171, 239
TscAI	CASTG	1 cut(s)	357
TspDTI	ATGAA	2 cut(s)	172, 348
TspRI	CASTG	1 cut(s)	357
XspI	CTAG	4 cut(s)	120, 299, 369, 379

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.