Rh5BG332100

Subunit of the peripheral V1 complex of vacuolar ATPase. Subunit C is necessary for the assembly of the catalytic sector of the enzyme and is likely to have a specific function in its catalytic activity. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
46168380 .. 46168985
606 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG332100.1

Sequence Viewer

Length: 279 bp
ATGGCGAGCAGGTACTGGGTGGTGTCTCTGCCTGTCCAAAACTCAACGTCGTATTTATGGAACCACCTCCAGGATCAAATCTCCAAGCATTCCTTCGACACTCCCCTCTACAGATCCAACAACTTTGTAGAGGCTGTTTCTCACAAGATCAAGTGTCAGATCAAGGAGCTAGAGAGGGTTTCAGGAGTCAAGAGCAGTTCTGTCACGGTGGATGGAGTTCCAATGGATTCATACCTCACTAGGTATTCATCACATCACTTATCATTAGCTTTTCCATAA

Protein Analysis

92

Amino Acids

10.53

Weight (kDa)

8.82

Isoelectric Point (pI)

32.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 81, 108
AfaI GTAC 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 70
AjnI CCWGG 1 cut(s) 69
AjuI GAANNNNNNNTTGG 2 cut(s) 77, 109
AluBI AGCT 2 cut(s) 169, 269
AluI AGCT 2 cut(s) 169, 269
Alw26I GTCTC 1 cut(s) 30
AlwI GGATC 2 cut(s) 81, 108
AlwNI CAGNNNCTG 1 cut(s) 15
BccI CCATC 1 cut(s) 206
BciT130I CCWGG 1 cut(s) 71
BcoDI GTCTC 1 cut(s) 30
BfaI CTAG 2 cut(s) 170, 240
BfmI CTRYAG 1 cut(s) 109
Bme1390I CCNGG 1 cut(s) 71
BmiI GGNNCC 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 71
BmrI ACTGGG 1 cut(s) 25
BmuI ACTGGG 1 cut(s) 25
BpmI CTGGAG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 70
Bse1I ACTGG 1 cut(s) 20
BseBI CCWGG 1 cut(s) 71
BseGI GGATG 1 cut(s) 217
BseLI CCNNNNNNNGG 1 cut(s) 70
BseNI ACTGG 1 cut(s) 20
BslI CCNNNNNNNGG 1 cut(s) 70
BsmAI GTCTC 1 cut(s) 30
BsmI GAATGC 1 cut(s) 88
Bsp143I GATC 4 cut(s) 73, 113, 147, 159
BspLI GGNNCC 1 cut(s) 62
BspPI GGATC 2 cut(s) 81, 108
BsrI ACTGG 1 cut(s) 20
BssMI GATC 4 cut(s) 73, 113, 147, 159
Bst2UI CCWGG 1 cut(s) 71
Bst4CI ACNGT 1 cut(s) 208
BstC8I GCNNGC 1 cut(s) 7
BstF5I GGATG 1 cut(s) 217
BstKTI GATC 4 cut(s) 76, 116, 150, 162
BstMAI GTCTC 1 cut(s) 30
BstMBI GATC 4 cut(s) 73, 113, 147, 159
BstNI CCWGG 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 69
BstSFI CTRYAG 1 cut(s) 109
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BtsCI GGATG 1 cut(s) 217
Cac8I GCNNGC 1 cut(s) 7
CaiI CAGNNNCTG 1 cut(s) 15
Csp6I GTAC 1 cut(s) 13
CviJI RGCY 3 cut(s) 134, 169, 269
CviKI_1 RGCY 3 cut(s) 134, 169, 269
CviQI GTAC 1 cut(s) 13
DpnI GATC 4 cut(s) 75, 115, 149, 161
DpnII GATC 4 cut(s) 73, 113, 147, 159
EcoRII CCWGG 1 cut(s) 69
FaiI YATR 3 cut(s) 58, 232, 277
FalI AAGNNNNNCTT 2 cut(s) 77, 109
FokI GGATG 1 cut(s) 224
FspBI CTAG 2 cut(s) 170, 240
GsuI CTGGAG 1 cut(s) 53
HinfI GANTC 2 cut(s) 186, 227
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 2 cut(s) 183, 190
Hpy99I CGWCG 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 1 cut(s) 208
HpyCH4IV ACGT 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 47
Kzo9I GATC 4 cut(s) 73, 113, 147, 159
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 4 cut(s) 45, 56, 83, 168
MaeI CTAG 2 cut(s) 170, 240
MaeII ACGT 1 cut(s) 47
MaeIII GTNAC 1 cut(s) 202
MalI GATC 4 cut(s) 75, 115, 149, 161
MboI GATC 4 cut(s) 73, 113, 147, 159
MflI RGATCY 1 cut(s) 113
MlyI GAGTC 1 cut(s) 195
MmeI TCCRAC 1 cut(s) 141
MnlI CCTC 5 cut(s) 77, 116, 124, 168, 245
MspR9I CCNGG 1 cut(s) 71
Mva1269I GAATGC 1 cut(s) 88
MvaI CCWGG 1 cut(s) 71
NdeII GATC 4 cut(s) 73, 113, 147, 159
NlaIV GGNNCC 1 cut(s) 62
NmuCI GTSAC 1 cut(s) 202
PctI GAATGC 1 cut(s) 88
PfeI GAWTC 1 cut(s) 227
PfoI TCCNGGA 1 cut(s) 69
PleI GAGTC 1 cut(s) 194
PpsI GAGTC 1 cut(s) 194
Psp6I CCWGG 1 cut(s) 69
PspGI CCWGG 1 cut(s) 69
PspN4I GGNNCC 1 cut(s) 62
PstNI CAGNNNCTG 1 cut(s) 15
PsuI RGATCY 1 cut(s) 113
RsaI GTAC 1 cut(s) 14
RsaNI GTAC 1 cut(s) 13
Sau3AI GATC 4 cut(s) 73, 113, 147, 159
SchI GAGTC 1 cut(s) 195
ScrFI CCNGG 1 cut(s) 71
SetI ASST 7 cut(s) 14, 50, 69, 171, 237, 245, 271
SfcI CTRYAG 1 cut(s) 109
SspMI CTAG 2 cut(s) 170, 240
StyD4I CCNGG 1 cut(s) 69
TaaI ACNGT 1 cut(s) 208
TaiI ACGT 1 cut(s) 50
TaqI TCGA 1 cut(s) 96
TfiI GAWTC 1 cut(s) 227
TseFI GTSAC 1 cut(s) 202
Tsp45I GTSAC 1 cut(s) 202
TspDTI ATGAA 2 cut(s) 219, 237
XspI CTAG 2 cut(s) 170, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.