Rmu_sc0000493.1_g000050

Subunit of the peripheral V1 complex of vacuolar ATPase. Subunit C is necessary for the assembly of the catalytic sector of the enzyme and is likely to have a specific function in its catalytic activity. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000493.1
Physical Location & Seq
Reverse (-)
219798 .. 220391
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000493.1_g000050.1.cds

Sequence Viewer

Length: 228 bp
atggaaccacctccaggatcaaatctccaagcattcctacagattcaatattcccaatctcttctctccctcagcgacgatctcttaaagtccaacaactttgtagagggtgtttctcacaagatcaggtgtcagatcaaggagctagagagggtttcaggagtcaagagcagttctctcacggtggatggagttccagtggattcatacctgactaggtttgtctag

Protein Analysis

75

Amino Acids

8.3

Weight (kDa)

5.64

Isoelectric Point (pI)

38.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 14
AgsI TTSAA 1 cut(s) 47
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
AlwI GGATC 1 cut(s) 25
BbvCI CCTCAGC 1 cut(s) 71
BccI CCATC 1 cut(s) 182
BciT130I CCWGG 1 cut(s) 15
BfaI CTAG 3 cut(s) 146, 216, 226
BfmI CTRYAG 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 15
BplI GAGNNNNNCTC 2 cut(s) 160, 192
Bpu10I CCTNAGC 1 cut(s) 71
BsaXI ACNNNNNCTCC 2 cut(s) 183, 213
Bsc4I CCNNNNNNNGG 1 cut(s) 14
Bse1I ACTGG 1 cut(s) 197
BseBI CCWGG 1 cut(s) 15
BseGI GGATG 1 cut(s) 193
BseLI CCNNNNNNNGG 1 cut(s) 14
BseMII CTCAG 1 cut(s) 85
BseNI ACTGG 1 cut(s) 197
BslI CCNNNNNNNGG 1 cut(s) 14
BsmI GAATGC 1 cut(s) 32
Bsp143I GATC 4 cut(s) 17, 79, 123, 135
BspCNI CTCAG 1 cut(s) 84
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 25
BsrI ACTGG 1 cut(s) 197
BssMI GATC 4 cut(s) 17, 79, 123, 135
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 184
Bst6I CTCTTC 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 71
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 4 cut(s) 20, 82, 126, 138
BstMBI GATC 4 cut(s) 17, 79, 123, 135
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 38
BtsCI GGATG 1 cut(s) 193
BtsIMutI CAGTG 1 cut(s) 204
CviJI RGCY 1 cut(s) 145
CviKI_1 RGCY 1 cut(s) 145
DdeI CTNAG 1 cut(s) 71
DpnI GATC 4 cut(s) 19, 81, 125, 137
DpnII GATC 4 cut(s) 17, 79, 123, 135
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
EcoRII CCWGG 1 cut(s) 13
FaiI YATR 1 cut(s) 208
FokI GGATG 1 cut(s) 200
FspBI CTAG 3 cut(s) 146, 216, 226
HinfI GANTC 3 cut(s) 43, 162, 203
Hpy188I TCNGA 1 cut(s) 135
Hpy188III TCNNGA 2 cut(s) 159, 166
Hpy99I CGWCG 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 184
HpyF3I CTNAG 1 cut(s) 71
Kzo9I GATC 4 cut(s) 17, 79, 123, 135
LmnI GCTCC 1 cut(s) 142
LpnPI CCDG 5 cut(s) 27, 112, 144, 210, 224
MaeI CTAG 3 cut(s) 146, 216, 226
MalI GATC 4 cut(s) 19, 81, 125, 137
MboI GATC 4 cut(s) 17, 79, 123, 135
MboII GAAGA 1 cut(s) 53
MlyI GAGTC 1 cut(s) 171
MmeI TCCRAC 1 cut(s) 117
MnlI CCTC 4 cut(s) 21, 80, 100, 144
MseI TTAA 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 32
MvaI CCWGG 1 cut(s) 15
NdeII GATC 4 cut(s) 17, 79, 123, 135
NlaIV GGNNCC 1 cut(s) 6
PctI GAATGC 1 cut(s) 32
PfeI GAWTC 2 cut(s) 43, 203
PfoI TCCNGGA 1 cut(s) 13
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 86
Sau3AI GATC 4 cut(s) 17, 79, 123, 135
SchI GAGTC 1 cut(s) 171
ScrFI CCNGG 1 cut(s) 15
SetI ASST 5 cut(s) 13, 131, 147, 213, 221
SfcI CTRYAG 1 cut(s) 38
SspI AATATT 1 cut(s) 50
SspMI CTAG 3 cut(s) 146, 216, 226
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 184
TfiI GAWTC 2 cut(s) 43, 203
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TscAI CASTG 1 cut(s) 204
TspDTI ATGAA 1 cut(s) 195
TspRI CASTG 1 cut(s) 204
XspI CTAG 3 cut(s) 146, 216, 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.