Rh1AG159500

Subunit of the peripheral V1 complex of vacuolar ATPase. Subunit C is necessary for the assembly of the catalytic sector of the enzyme and is likely to have a specific function in its catalytic activity. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
30225605 .. 30226270
666 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG159500.1

Sequence Viewer

Length: 339 bp
ATGTCGGCGATAGATAAGAGTTTGAGTAAGAGGAGAAGAGAGAGGAAAGAAAGTGAAAGAATGGCGAGCAAGTACTGGGTGGTGTCTCTGCCTGTCCAAAACTCAACGTCGTATTTATGGAACCACCTCCAGGATCAAATCTCCAAGCATTCCTTCGACACTCCCCTCTACAGATCCAACAACTTTGTAGAGGGTGTTTCTCACAAGATCAGGTGTCAGATCAAGGAACTAGAGAGGGTTTCAGGAGTCAAGAGCAGTTCTCTCACAGTGGATGGAATTCCAGTGGATTCATACCTCACTAGGTATTCATCACATCACTTATCATTAGCTTTTCCATAA

Protein Analysis

112

Amino Acids

12.96

Weight (kDa)

9.67

Isoelectric Point (pI)

46.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 141, 168
AcsI RAATTY 1 cut(s) 276
AfaI GTAC 1 cut(s) 74
AfiI CCNNNNNNNGG 1 cut(s) 130
AjnI CCWGG 1 cut(s) 129
AjuI GAANNNNNNNTTGG 2 cut(s) 137, 169
AluBI AGCT 1 cut(s) 329
AluI AGCT 1 cut(s) 329
Alw26I GTCTC 1 cut(s) 90
AlwI GGATC 2 cut(s) 141, 168
ApoI RAATTY 1 cut(s) 276
BccI CCATC 1 cut(s) 266
BciT130I CCWGG 1 cut(s) 131
BcoDI GTCTC 1 cut(s) 90
BfaI CTAG 2 cut(s) 230, 300
BfmI CTRYAG 1 cut(s) 169
BmcAI AGTACT 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 131
BmiI GGNNCC 1 cut(s) 122
BmrFI CCNGG 1 cut(s) 131
BmrI ACTGGG 1 cut(s) 85
BmuI ACTGGG 1 cut(s) 85
BplI GAGNNNNNCTC 2 cut(s) 244, 276
BpmI CTGGAG 1 cut(s) 113
Bsc4I CCNNNNNNNGG 1 cut(s) 130
Bse1I ACTGG 2 cut(s) 80, 281
BseBI CCWGG 1 cut(s) 131
BseGI GGATG 1 cut(s) 277
BseLI CCNNNNNNNGG 1 cut(s) 130
BseNI ACTGG 2 cut(s) 80, 281
BseRI GAGGAG 1 cut(s) 46
BslI CCNNNNNNNGG 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 90
BsmI GAATGC 1 cut(s) 148
Bsp143I GATC 4 cut(s) 133, 173, 207, 219
BspLI GGNNCC 1 cut(s) 122
BspPI GGATC 2 cut(s) 141, 168
BsrI ACTGG 2 cut(s) 80, 281
BssMI GATC 4 cut(s) 133, 173, 207, 219
Bst2UI CCWGG 1 cut(s) 131
Bst4CI ACNGT 1 cut(s) 268
Bst6I CTCTTC 1 cut(s) 31
BstC8I GCNNGC 1 cut(s) 67
BstF5I GGATG 1 cut(s) 277
BstKTI GATC 4 cut(s) 136, 176, 210, 222
BstMAI GTCTC 1 cut(s) 90
BstMBI GATC 4 cut(s) 133, 173, 207, 219
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 129
BstSFI CTRYAG 1 cut(s) 169
BstX2I RGATCY 1 cut(s) 173
BstYI RGATCY 1 cut(s) 173
BtsCI GGATG 1 cut(s) 277
BtsIMutI CAGTG 2 cut(s) 273, 288
Cac8I GCNNGC 1 cut(s) 67
Csp6I GTAC 1 cut(s) 73
CviJI RGCY 1 cut(s) 329
CviKI_1 RGCY 1 cut(s) 329
CviQI GTAC 1 cut(s) 73
DpnI GATC 4 cut(s) 135, 175, 209, 221
DpnII GATC 4 cut(s) 133, 173, 207, 219
Eam1104I CTCTTC 1 cut(s) 31
EarI CTCTTC 1 cut(s) 31
EcoRI GAATTC 1 cut(s) 276
EcoRII CCWGG 1 cut(s) 129
FaiI YATR 3 cut(s) 118, 292, 337
FalI AAGNNNNNCTT 2 cut(s) 137, 169
FokI GGATG 1 cut(s) 284
FspBI CTAG 2 cut(s) 230, 300
GsuI CTGGAG 1 cut(s) 113
HinfI GANTC 2 cut(s) 246, 287
Hpy188I TCNGA 1 cut(s) 219
Hpy188III TCNNGA 2 cut(s) 243, 250
Hpy99I CGWCG 1 cut(s) 112
HpyAV CCTTC 1 cut(s) 163
HpyCH4III ACNGT 1 cut(s) 268
HpyCH4IV ACGT 1 cut(s) 107
HpySE526I ACGT 1 cut(s) 107
Kzo9I GATC 4 cut(s) 133, 173, 207, 219
LpnPI CCDG 7 cut(s) 61, 105, 116, 143, 196, 228, 294
MaeI CTAG 2 cut(s) 230, 300
MaeII ACGT 1 cut(s) 107
MalI GATC 4 cut(s) 135, 175, 209, 221
MboI GATC 4 cut(s) 133, 173, 207, 219
MboII GAAGA 1 cut(s) 48
MflI RGATCY 1 cut(s) 173
MluCI AATT 1 cut(s) 276
MlyI GAGTC 1 cut(s) 255
MmeI TCCRAC 1 cut(s) 201
MnlI CCTC 7 cut(s) 24, 36, 137, 176, 184, 228, 305
MspR9I CCNGG 1 cut(s) 131
Mva1269I GAATGC 1 cut(s) 148
MvaI CCWGG 1 cut(s) 131
NdeII GATC 4 cut(s) 133, 173, 207, 219
NlaIV GGNNCC 1 cut(s) 122
PctI GAATGC 1 cut(s) 148
PfeI GAWTC 1 cut(s) 287
PfoI TCCNGGA 1 cut(s) 129
PleI GAGTC 1 cut(s) 254
PpsI GAGTC 1 cut(s) 254
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
PspN4I GGNNCC 1 cut(s) 122
PsuI RGATCY 1 cut(s) 173
RsaI GTAC 1 cut(s) 74
RsaNI GTAC 1 cut(s) 73
Sau3AI GATC 4 cut(s) 133, 173, 207, 219
ScaI AGTACT 1 cut(s) 74
SchI GAGTC 1 cut(s) 255
ScrFI CCNGG 1 cut(s) 131
SetI ASST 6 cut(s) 110, 129, 215, 297, 305, 331
SfcI CTRYAG 1 cut(s) 169
Sse9I AATT 1 cut(s) 276
SspMI CTAG 2 cut(s) 230, 300
StyD4I CCNGG 1 cut(s) 129
TaaI ACNGT 1 cut(s) 268
TaiI ACGT 1 cut(s) 110
TaqI TCGA 1 cut(s) 156
TasI AATT 1 cut(s) 276
TatI WGTACW 1 cut(s) 72
TfiI GAWTC 1 cut(s) 287
TscAI CASTG 2 cut(s) 273, 288
TspDTI ATGAA 2 cut(s) 279, 297
TspRI CASTG 2 cut(s) 273, 288
XapI RAATTY 1 cut(s) 276
XspI CTAG 2 cut(s) 230, 300
ZrmI AGTACT 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.