Rh5CG428800

Subunit of the peripheral V1 complex of vacuolar ATPase. Subunit C is necessary for the assembly of the catalytic sector of the enzyme and is likely to have a specific function in its catalytic activity. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
59415386 .. 59415935
550 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG428800.1

Sequence Viewer

Length: 270 bp
ATGGAACCACCTCCAGGATCAAATCTCCAAGCATTCCTTCGACACTCCCCTCTACAGATTCAATATTCCCAATCTCTTCTCTCCCTTAGCGACGATCTCTTAAAGTCCAAAAACTTTGTAGAGGGTGTTTCTCACAAGATCAGGTGTCAGATCAAGGAGCTAGAGAGGGTTTTAGGAGTCAAGAGCAGTTCTCTCACGGTGGATGGAGTTCCAGTGGATTCATACCTCACTAGGTATTCATCATATCACTTATCATTAGCTTTTCCATAA

Protein Analysis

89

Amino Acids

9.95

Weight (kDa)

7.91

Isoelectric Point (pI)

48.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
V-ATPase_C PF03223 18 - 80 3.2e-07 V-ATPase subunit C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 14
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 13
AjuI GAANNNNNNNTTGG 2 cut(s) 21, 53
AluBI AGCT 2 cut(s) 160, 260
AluI AGCT 2 cut(s) 160, 260
AlwI GGATC 1 cut(s) 25
BccI CCATC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 15
BfaI CTAG 2 cut(s) 161, 231
BfmI CTRYAG 1 cut(s) 53
Bme1390I CCNGG 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 15
BplI GAGNNNNNCTC 2 cut(s) 175, 207
Bpu10I CCTNAGC 1 cut(s) 86
BsaXI ACNNNNNCTCC 2 cut(s) 198, 228
Bsc4I CCNNNNNNNGG 1 cut(s) 14
Bse1I ACTGG 1 cut(s) 212
BseBI CCWGG 1 cut(s) 15
BseGI GGATG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 14
BseNI ACTGG 1 cut(s) 212
BslI CCNNNNNNNGG 1 cut(s) 14
BsmI GAATGC 1 cut(s) 32
Bsp143I GATC 4 cut(s) 17, 94, 138, 150
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 25
BsrI ACTGG 1 cut(s) 212
BssMI GATC 4 cut(s) 17, 94, 138, 150
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 199
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 86
BstF5I GGATG 1 cut(s) 208
BstKTI GATC 4 cut(s) 20, 97, 141, 153
BstMBI GATC 4 cut(s) 17, 94, 138, 150
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 53
BtsCI GGATG 1 cut(s) 208
BtsIMutI CAGTG 1 cut(s) 219
CviJI RGCY 2 cut(s) 160, 260
CviKI_1 RGCY 2 cut(s) 160, 260
DdeI CTNAG 1 cut(s) 86
DpnI GATC 4 cut(s) 19, 96, 140, 152
DpnII GATC 4 cut(s) 17, 94, 138, 150
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 13
FaiI YATR 3 cut(s) 223, 244, 268
FalI AAGNNNNNCTT 2 cut(s) 21, 53
FokI GGATG 1 cut(s) 215
FspBI CTAG 2 cut(s) 161, 231
HinfI GANTC 3 cut(s) 58, 177, 218
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 181
Hpy99I CGWCG 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 199
HpyF3I CTNAG 1 cut(s) 86
Kzo9I GATC 4 cut(s) 17, 94, 138, 150
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 3 cut(s) 27, 127, 225
MaeI CTAG 2 cut(s) 161, 231
MalI GATC 4 cut(s) 19, 96, 140, 152
MboI GATC 4 cut(s) 17, 94, 138, 150
MboII GAAGA 1 cut(s) 68
MlyI GAGTC 1 cut(s) 186
MnlI CCTC 5 cut(s) 21, 60, 115, 159, 236
MseI TTAA 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 32
MvaI CCWGG 1 cut(s) 15
NdeII GATC 4 cut(s) 17, 94, 138, 150
NlaIV GGNNCC 1 cut(s) 6
PctI GAATGC 1 cut(s) 32
PfeI GAWTC 2 cut(s) 58, 218
PfoI TCCNGGA 1 cut(s) 13
PleI GAGTC 1 cut(s) 185
PpsI GAGTC 1 cut(s) 185
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 4 cut(s) 17, 94, 138, 150
SchI GAGTC 1 cut(s) 186
ScrFI CCNGG 1 cut(s) 15
SetI ASST 6 cut(s) 13, 146, 162, 228, 236, 262
SfcI CTRYAG 1 cut(s) 53
SspI AATATT 1 cut(s) 65
SspMI CTAG 2 cut(s) 161, 231
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 199
TaqI TCGA 1 cut(s) 40
TfiI GAWTC 2 cut(s) 58, 218
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TscAI CASTG 1 cut(s) 219
TspDTI ATGAA 2 cut(s) 210, 228
TspRI CASTG 1 cut(s) 219
XspI CTAG 2 cut(s) 161, 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.