Rmu_sc0000367.1_g000154

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000367.1
OG0016467
Physical Location & Seq
Forward (+)
753946 .. 754473
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000367.1_g000154.1.cds

Sequence Viewer

Length: 528 bp
atgatccgtgtttaccagagaataaagcaaactgggggagaattgtttagttggcagcgaaatactttttggtttcgccaggttgagatgagagctgtgagaacttgtctagatgaattgttgaaagccccttttagtgccaatgatcttgcagagaagcaaactctccaggccaagttccaggaattgcgtacgcaggaagaaactatgtggattcagaggactagggtattatggttgaaggcaggagaccgtaatacggcttatttccaccgttgtgcttcaaaaaggaggcagcggaatatgattatgggcttatttgatgagtcaggcagatgggtgaatgaggctcaagaaattgagggggtaattaattcttattatcaaaagctatttctcacagaggagtctaacaatacttctagggacatgattcttaataccgtgctgtctaaggtatctgaagccatgaaccaagaactgttggctccctattccgatgacgaagtgaagattgcgttgatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

175

Amino Acids

20.74

Weight (kDa)

8.56

Isoelectric Point (pI)

46.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 298
AcuI CTGAAG 1 cut(s) 483
AfaI GTAC 1 cut(s) 193
AfiI CCNNNNNNNGG 1 cut(s) 259
AgsI TTSAA 3 cut(s) 124, 241, 285
AjnI CCWGG 3 cut(s) 78, 168, 180
AjuI GAANNNNNNNTTGG 2 cut(s) 52, 84
AleI CACNNNNGTG 1 cut(s) 276
AluBI AGCT 2 cut(s) 95, 391
AluI AGCT 2 cut(s) 95, 391
Alw26I GTCTC 1 cut(s) 243
AoxI GGCC 1 cut(s) 171
ApeKI GCWGC 2 cut(s) 55, 295
AseI ATTAAT 1 cut(s) 372
AsuHPI GGTGA 1 cut(s) 352
BbvI GCAGC 2 cut(s) 67, 307
BccI CCATC 1 cut(s) 330
BceAI ACGGC 1 cut(s) 276
BciT130I CCWGG 3 cut(s) 80, 170, 182
BcoDI GTCTC 1 cut(s) 243
BfaI CTAG 4 cut(s) 110, 225, 423, 526
BisI GCNGC 2 cut(s) 56, 296
BlsI GCNGC 2 cut(s) 57, 297
Bme1390I CCNGG 3 cut(s) 80, 170, 182
BmiI GGNNCC 1 cut(s) 489
BmrFI CCNGG 3 cut(s) 80, 170, 182
BmrI ACTGGG 1 cut(s) 42
BmuI ACTGGG 1 cut(s) 42
BpmI CTGGAG 1 cut(s) 152
BpuEI CTTGAG 1 cut(s) 336
BsaI GGTCTC 1 cut(s) 243
Bsc4I CCNNNNNNNGG 1 cut(s) 259
Bse1I ACTGG 1 cut(s) 37
BseBI CCWGG 3 cut(s) 80, 170, 182
BseLI CCNNNNNNNGG 1 cut(s) 259
BseNI ACTGG 1 cut(s) 37
BseRI GAGGAG 1 cut(s) 419
BseXI GCAGC 2 cut(s) 67, 307
BshFI GGCC 1 cut(s) 173
BsiWI CGTACG 1 cut(s) 191
BslFI GGGAC 1 cut(s) 440
BslI CCNNNNNNNGG 1 cut(s) 259
BsmAI GTCTC 1 cut(s) 243
BsmFI GGGAC 1 cut(s) 440
BsnI GGCC 1 cut(s) 173
Bso31I GGTCTC 1 cut(s) 243
Bsp143I GATC 3 cut(s) 3, 145, 522
BspACI CCGC 1 cut(s) 298
BspANI GGCC 1 cut(s) 173
BspLI GGNNCC 1 cut(s) 489
BspTNI GGTCTC 1 cut(s) 243
BsrI ACTGG 1 cut(s) 37
BssMI GATC 3 cut(s) 3, 145, 522
Bst2UI CCWGG 3 cut(s) 80, 170, 182
Bst4CI ACNGT 4 cut(s) 254, 275, 445, 483
BstDEI CTNAG 1 cut(s) 453
BstKTI GATC 3 cut(s) 6, 148, 525
BstMAI GTCTC 1 cut(s) 243
BstMBI GATC 3 cut(s) 3, 145, 522
BstNI CCWGG 3 cut(s) 80, 170, 182
BstSCI CCNGG 3 cut(s) 78, 168, 180
BstV1I GCAGC 2 cut(s) 67, 307
BsuRI GGCC 1 cut(s) 173
Csp6I GTAC 1 cut(s) 192
CviAII CATG 2 cut(s) 430, 469
CviJI RGCY 9 cut(s) 95, 128, 173, 263, 315, 350, 391, 467, 488
CviKI_1 RGCY 9 cut(s) 95, 128, 173, 263, 315, 350, 391, 467, 488
CviQI GTAC 1 cut(s) 192
DdeI CTNAG 1 cut(s) 453
DpnI GATC 3 cut(s) 5, 147, 524
DpnII GATC 3 cut(s) 3, 145, 522
Eco31I GGTCTC 1 cut(s) 243
Eco57I CTGAAG 1 cut(s) 483
EcoRII CCWGG 3 cut(s) 78, 168, 180
FaeI CATG 2 cut(s) 433, 472
FaiI YATR 6 cut(s) 209, 235, 305, 311, 431, 470
FaqI GGGAC 1 cut(s) 440
FatI CATG 2 cut(s) 429, 468
Fnu4HI GCNGC 2 cut(s) 56, 296
Fsp4HI GCNGC 2 cut(s) 56, 296
FspBI CTAG 4 cut(s) 110, 225, 423, 526
GluI GCNGC 2 cut(s) 56, 296
GsuI CTGGAG 1 cut(s) 152
HaeIII GGCC 1 cut(s) 173
Hin1II CATG 2 cut(s) 433, 472
HinfI GANTC 4 cut(s) 214, 326, 407, 433
HphI GGTGA 1 cut(s) 352
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 3 cut(s) 219, 463, 499
Hpy188III TCNNGA 2 cut(s) 110, 353
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 235
HpyCH4III ACNGT 4 cut(s) 254, 275, 445, 483
HpyCH4V TGCA 1 cut(s) 152
HpyF3I CTNAG 1 cut(s) 453
Hsp92II CATG 2 cut(s) 433, 472
Kzo9I GATC 3 cut(s) 3, 145, 522
LmnI GCTCC 1 cut(s) 493
Lsp1109I GCAGC 2 cut(s) 67, 307
MaeI CTAG 4 cut(s) 110, 225, 423, 526
MalI GATC 3 cut(s) 5, 147, 524
MboI GATC 3 cut(s) 3, 145, 522
MboII GAAGA 2 cut(s) 212, 523
MluCI AATT 6 cut(s) 41, 116, 185, 357, 369, 373
MlyI GAGTC 2 cut(s) 335, 416
MnlI CCTC 5 cut(s) 213, 285, 340, 355, 397
MseI TTAA 2 cut(s) 372, 438
MslI CAYNNNNRTG 1 cut(s) 276
MspA1I CMGCKG 1 cut(s) 298
MspR9I CCNGG 3 cut(s) 80, 170, 182
MvaI CCWGG 3 cut(s) 80, 170, 182
NdeII GATC 3 cut(s) 3, 145, 522
NlaIII CATG 2 cut(s) 433, 472
NlaIV GGNNCC 1 cut(s) 489
OliI CACNNNNGTG 1 cut(s) 276
PfeI GAWTC 2 cut(s) 214, 433
Pfl23II CGTACG 1 cut(s) 191
PfoI TCCNGGA 1 cut(s) 180
PkrI GCNGC 2 cut(s) 57, 297
PleI GAGTC 2 cut(s) 334, 415
PpsI GAGTC 2 cut(s) 334, 415
PshBI ATTAAT 1 cut(s) 372
Psp6I CCWGG 3 cut(s) 78, 168, 180
PspGI CCWGG 3 cut(s) 78, 168, 180
PspLI CGTACG 1 cut(s) 191
PspN4I GGNNCC 1 cut(s) 489
RsaI GTAC 1 cut(s) 193
RsaNI GTAC 1 cut(s) 192
RseI CAYNNNNRTG 1 cut(s) 276
SaqAI TTAA 2 cut(s) 372, 438
SatI GCNGC 2 cut(s) 56, 296
Sau3AI GATC 3 cut(s) 3, 145, 522
SchI GAGTC 2 cut(s) 335, 416
ScrFI CCNGG 3 cut(s) 80, 170, 182
SetI ASST 4 cut(s) 84, 97, 393, 459
SmiMI CAYNNNNRTG 1 cut(s) 276
SmlI CTYRAG 1 cut(s) 351
SmoI CTYRAG 1 cut(s) 351
Sse9I AATT 6 cut(s) 41, 116, 185, 357, 369, 373
SsiI CCGC 1 cut(s) 298
SspMI CTAG 4 cut(s) 110, 225, 423, 526
StyD4I CCNGG 3 cut(s) 78, 168, 180
TaaI ACNGT 4 cut(s) 254, 275, 445, 483
TasI AATT 6 cut(s) 41, 116, 185, 357, 369, 373
TfiI GAWTC 2 cut(s) 214, 433
Tru1I TTAA 2 cut(s) 372, 438
Tru9I TTAA 2 cut(s) 372, 438
TseI GCWGC 2 cut(s) 55, 295
TspDTI ATGAA 2 cut(s) 129, 485
VspI ATTAAT 1 cut(s) 372
XbaI TCTAGA 1 cut(s) 109
XspI CTAG 4 cut(s) 110, 225, 423, 526
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.