Rmu_sc0001176.1_g000010

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001176.1
OG0016467
Physical Location & Seq
Reverse (-)
33634 .. 34056
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001176.1_g000010.1.cds

Sequence Viewer

Length: 423 bp
atgttgggggttagagatagacttgaggagctcatggatgtacctattaacgaggcagtacaagctgaaaagcactcgttaatgtgtcgtctgcaaactttgctttctcaagaagaaagcttctggaaacaaagatcaaaggtccaatggcttaaagagggggaccataataccggtttctttcaccgcaaggcatcaaacaggaagaggaagaatctaatccaaggtctgtatgatgacaatggcaattggtgtgaagatgatgctgatattgagagaatagtttcatcctattttgctaacatgtttcaagcttcagagctggattttgaggctatggaaacaactattgaggctatacaaccttgtgtgtctgaagagatgaaccatcgttgggtttgccatattcaggagaggagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

140

Amino Acids

16.61

Weight (kDa)

5.24

Isoelectric Point (pI)

55.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 187
AcuI CTGAAG 2 cut(s) 300, 396
AfaI GTAC 2 cut(s) 42, 60
AfiI CCNNNNNNNGG 2 cut(s) 394, 409
AflIII ACRYGT 1 cut(s) 303
AgeI ACCGGT 1 cut(s) 173
AgsI TTSAA 1 cut(s) 311
AluBI AGCT 5 cut(s) 31, 65, 120, 314, 322
AluI AGCT 5 cut(s) 31, 65, 120, 314, 322
Alw21I GWGCWC 1 cut(s) 33
AsiGI ACCGGT 1 cut(s) 173
Asp700I GAANNNNTTC 1 cut(s) 283
AspS9I GGNCC 2 cut(s) 142, 163
AsuHPI GGTGA 1 cut(s) 176
AvaII GGWCC 2 cut(s) 142, 163
BanII GRGCYC 1 cut(s) 33
Bbv12I GWGCWC 1 cut(s) 33
BccI CCATC 1 cut(s) 396
Bme18I GGWCC 2 cut(s) 142, 163
BmgT120I GGNCC 2 cut(s) 142, 163
BmiI GGNNCC 1 cut(s) 164
BmsI GCATC 2 cut(s) 203, 253
BpuEI CTTGAG 2 cut(s) 44, 93
BsaJI CCNNGG 1 cut(s) 223
BsaWI WCCGGW 1 cut(s) 173
Bsc4I CCNNNNNNNGG 2 cut(s) 394, 409
Bse118I RCCGGY 1 cut(s) 173
BseDI CCNNGG 1 cut(s) 223
BseGI GGATG 2 cut(s) 43, 287
BseLI CCNNNNNNNGG 2 cut(s) 394, 409
BseRI GAGGAG 1 cut(s) 41
BshTI ACCGGT 1 cut(s) 173
BsiHKAI GWGCWC 1 cut(s) 33
BsiSI CCGG 1 cut(s) 174
BslFI GGGAC 1 cut(s) 176
BslI CCNNNNNNNGG 2 cut(s) 394, 409
BsmFI GGGAC 1 cut(s) 176
Bsp1286I GDGCHC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 134
BspACI CCGC 1 cut(s) 187
BspLI GGNNCC 1 cut(s) 164
BsrFI RCCGGY 1 cut(s) 173
BssAI RCCGGY 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 223
BssMI GATC 1 cut(s) 134
BssT1I CCWWGG 1 cut(s) 223
Bst6I CTCTTC 2 cut(s) 200, 372
BstAPI GCANNNNNTGC 1 cut(s) 100
BstF5I GGATG 2 cut(s) 43, 287
BstKTI GATC 1 cut(s) 137
BstMBI GATC 1 cut(s) 134
BstMWI GCNNNNNNNGC 2 cut(s) 62, 100
BstNSI RCATGY 1 cut(s) 307
BtsCI GGATG 2 cut(s) 43, 287
Cfr10I RCCGGY 1 cut(s) 173
Cfr13I GGNCC 2 cut(s) 142, 163
Csp6I GTAC 2 cut(s) 41, 59
CspAI ACCGGT 1 cut(s) 173
CviAII CATG 2 cut(s) 34, 304
CviJI RGCY 8 cut(s) 31, 65, 120, 151, 314, 322, 335, 356
CviKI_1 RGCY 8 cut(s) 31, 65, 120, 151, 314, 322, 335, 356
CviQI GTAC 2 cut(s) 41, 59
DpnI GATC 1 cut(s) 136
DpnII GATC 1 cut(s) 134
Eam1104I CTCTTC 2 cut(s) 200, 372
EarI CTCTTC 2 cut(s) 200, 372
Ecl136II GAGCTC 1 cut(s) 31
Eco130I CCWWGG 1 cut(s) 223
Eco24I GRGCYC 1 cut(s) 33
Eco47I GGWCC 2 cut(s) 142, 163
Eco53kI GAGCTC 1 cut(s) 31
Eco57I CTGAAG 2 cut(s) 300, 396
EcoICRI GAGCTC 1 cut(s) 31
EcoT14I CCWWGG 1 cut(s) 223
EcoT38I GRGCYC 1 cut(s) 33
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 2 cut(s) 37, 307
FaiI YATR 7 cut(s) 35, 168, 234, 305, 338, 359, 405
FaqI GGGAC 1 cut(s) 176
FatI CATG 2 cut(s) 33, 303
FokI GGATG 2 cut(s) 50, 274
FriOI GRGCYC 1 cut(s) 33
HapII CCGG 1 cut(s) 174
Hin1II CATG 2 cut(s) 37, 307
HindIII AAGCTT 2 cut(s) 118, 312
HinfI GANTC 1 cut(s) 214
HpaII CCGG 1 cut(s) 174
HphI GGTGA 1 cut(s) 176
Hpy188I TCNGA 2 cut(s) 319, 376
Hpy188III TCNNGA 3 cut(s) 110, 124, 410
HpyCH4V TGCA 1 cut(s) 94
HpyF10VI GCNNNNNNNGC 2 cut(s) 62, 100
Hsp92II CATG 2 cut(s) 37, 307
Kzo9I GATC 1 cut(s) 134
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 5 cut(s) 109, 187, 187, 308, 395
LweI GCATC 2 cut(s) 203, 253
MalI GATC 1 cut(s) 136
MboI GATC 1 cut(s) 134
MboII GAAGA 5 cut(s) 125, 217, 223, 269, 389
MfeI CAATTG 1 cut(s) 247
MhlI GDGCHC 1 cut(s) 33
MluCI AATT 1 cut(s) 247
MnlI CCTC 7 cut(s) 19, 46, 151, 201, 325, 346, 408
MroXI GAANNNNTTC 1 cut(s) 283
MseI TTAA 3 cut(s) 48, 80, 153
MspI CCGG 1 cut(s) 174
MunI CAATTG 1 cut(s) 247
MwoI GCNNNNNNNGC 2 cut(s) 62, 100
NdeII GATC 1 cut(s) 134
NlaIII CATG 2 cut(s) 37, 307
NlaIV GGNNCC 1 cut(s) 164
NspI RCATGY 1 cut(s) 307
PciI ACATGT 1 cut(s) 303
PdmI GAANNNNTTC 1 cut(s) 283
PfeI GAWTC 1 cut(s) 214
PinAI ACCGGT 1 cut(s) 173
PscI ACATGT 1 cut(s) 303
Psp124BI GAGCTC 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 164
PspPI GGNCC 2 cut(s) 142, 163
RsaI GTAC 2 cut(s) 42, 60
RsaNI GTAC 2 cut(s) 41, 59
SacI GAGCTC 1 cut(s) 33
SaqAI TTAA 3 cut(s) 48, 80, 153
Sau3AI GATC 1 cut(s) 134
Sau96I GGNCC 2 cut(s) 142, 163
SduI GDGCHC 1 cut(s) 33
SetI ASST 9 cut(s) 33, 46, 67, 122, 144, 229, 316, 324, 367
SfaNI GCATC 2 cut(s) 203, 253
SinI GGWCC 2 cut(s) 142, 163
SmlI CTYRAG 2 cut(s) 23, 108
SmoI CTYRAG 2 cut(s) 23, 108
Sse9I AATT 1 cut(s) 247
SsiI CCGC 1 cut(s) 187
SstI GAGCTC 1 cut(s) 33
StyI CCWWGG 1 cut(s) 223
TasI AATT 1 cut(s) 247
TatI WGTACW 1 cut(s) 58
TfiI GAWTC 1 cut(s) 214
Tru1I TTAA 3 cut(s) 48, 80, 153
Tru9I TTAA 3 cut(s) 48, 80, 153
TspDTI ATGAA 2 cut(s) 276, 398
VpaK11BI GGWCC 2 cut(s) 142, 163
XceI RCATGY 1 cut(s) 307
XmnI GAANNNNTTC 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.