Rmu_sc0000388.1_g000006

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000388.1
Physical Location & Seq
Forward (+)
20226 .. 22202
1977 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000388.1_g000006.1.cds

Sequence Viewer

Length: 1977 bp
atgtacttccccgtcaagcatccgaccgttatttcccgcctcttttcctctcactctctgcaaaccaatgtcacccccaatttcaagacccaaattcaccaaaccctgcaccgcctcgtagagcaatgctcctccatgtcacacctcaagcaactccacgcccagatcatcctccaccgcctcaccaaccaaaacctcaccctcggaaagctcattgccttctgctccgtctccgacgccggagacctccgttacgctcaccttgtgtttgaccaagtccatcaacccaataaatttatgtacaatagtctaattagaggttactcaaatagcaatgactcattcatggctatgtctttgtattaccaaatgataaattccgggcttgcaccgaacgagttcacgttgccgtttgttcttaaggtttgcgccggaaaaacggcgttttgggaaggcgtggtggttcatggccaggctgttaagcttggaattgggtgtcaagtttgcgtgcaaaatgggcttattaatgtgtatggtgtttgtgggttgatacattttgcccggaatgtgtttgatgaaatgtctgagagaagtttggtgtcgtggaattcgatgataggtgggtatgctggagttggttcttggaaggaagcttttgggttgttcagggagatgagggatttcggcattgagcctgataagttcacattggttaatttactttctgtttgttcacaggcttgtgatttggagttggggagatatctgcatcactatactgtggttagcgggatggtggttgatcagattttgagaaatgctctgctggatatgtatggtaagtgtgggcatttgccttcggctcagatggttttcgaccaaatgagttacaaaaatgtggtttcttggacgtcgatggttagggcgtatgctagacatgggcgcattgaagttgcgcagaagttttttgatcagatgccactgaaaaatgtggtttcttggaattcactaatctcgtgttatgtgcgagaaggccaatgcagggaagctctggatctcttccagaaaatgctcaattctggtgaggtgcctgatgaggctaccttggttttcgctctctcagcctgtagtcaaattggcgatttggtcattggaaaggaaacccacaattacattagcaacagcaatatagcactcactgtaactctttctaattcccttgtagacatgtatgcaaaatgtggtgctgttggaactgctatagatctttttagtcagatgccagaaaagaatgtagtatcatggaacattgttattggtgcccttgcattgcacggttatggatcagaagcagttaggatatttgagcagatgcaagaaggtggaatctgtcctgatgagatcaccttcatcggattgctttctgcttgtagtcacagtggtcttctagacttggggagatattactatgacagaatgaagtctatttacagactctctcctgaaattgagcactatgcttgcatggttgatctgctgggacgacgtgggtgcttagaagaagcaattacactgatgagaggaatgccaatgaagcccgatattgttgtttggggtgctatgcttggtgcttgtcgcatccatggcaacatagatttagccaagctaattctaaaacagctgttggagttggagccacatggttctgggctttacgtgcttcttgcaaacatttttggtgaagctcacagatgggaagacgtcaagaatatcaggaaactaataaaagacggtggagtcatcaagtgtagagctgtgagctccattgaaattgatggttgtgtttatgaatttatggttgatgacaatagacatgcaatttcaagcagtatatactccatgctcgatcaattgacagatcatctgaagtctcttgtgtataatcctactgcaatgtgtgatttagaggaaccgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

658

Amino Acids

73.62

Weight (kDa)

6.31

Isoelectric Point (pI)

40.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017221)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g14410
malus_domestica MD02G1157600.v1.1
prunus_persica Prupe.7G146100_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0103131
rosa_laevigata RLG00000017212
rosa_multiflora Rmu_sc0000388.1_g000006
rosa_roxburghii Rroxscaffold_2G00139900
rosa_rugosa Rorug02G0112000
rosa_samantha Rh2AG160800 Rh2BG167500 Rh2CG167800 Rh2DG166400
rosa_wichuraiana Rw2G012590

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 1796
AatII GACGTC 2 cut(s) 914, 1764
Acc16I TGCGCA 1 cut(s) 957
AccB1I GGYRCC 2 cut(s) 1087, 1319
AccI GTMKAC 1 cut(s) 1224
AciI CCGC 4 cut(s) 37, 112, 178, 789
AclWI GGATC 2 cut(s) 1062, 1351
AcoI YGGCCR 1 cut(s) 469
AcsI RAATTY 6 cut(s) 93, 293, 376, 607, 1003, 1850
AcuI CTGAAG 1 cut(s) 1946
AcyI GRCGYC 3 cut(s) 237, 911, 1761
AdeI CACNNNGTG 1 cut(s) 265
AfaI GTAC 2 cut(s) 5, 302
AfiI CCNNNNNNNGG 1 cut(s) 1042
AflII CTTAAG 1 cut(s) 419
AflIII ACRYGT 1 cut(s) 1227
AgsI TTSAA 4 cut(s) 85, 950, 1829, 1884
AjiI CACGTC 1 cut(s) 1547
AjnI CCWGG 1 cut(s) 471
AluBI AGCT 9 cut(s) 211, 484, 653, 1049, 1666, 1681, 1745, 1814, 1821
AluI AGCT 9 cut(s) 211, 484, 653, 1049, 1666, 1681, 1745, 1814, 1821
Alw21I GWGCWC 2 cut(s) 1515, 1823
Alw26I GTCTC 3 cut(s) 235, 237, 1935
AlwI GGATC 2 cut(s) 1062, 1351
AoxI GGCC 2 cut(s) 469, 1033
ApoI RAATTY 6 cut(s) 93, 293, 376, 607, 1003, 1850
AseI ATTAAT 1 cut(s) 525
Asp700I GAANNNNTTC 1 cut(s) 398
AspLEI GCGC 3 cut(s) 431, 945, 958
AsuC2I CCSGG 2 cut(s) 382, 562
AsuHPI GGTGA 8 cut(s) 64, 89, 175, 190, 251, 1094, 1396, 1751
BaeGI GKGCMC 1 cut(s) 1324
BalI TGGCCA 1 cut(s) 471
BanI GGYRCC 2 cut(s) 1087, 1319
BanII GRGCYC 1 cut(s) 1823
BarI GAAGNNNNNNTAC 2 cut(s) 1472, 1504
BauI CACGAG 1 cut(s) 1015
BbsI GAAGAC 2 cut(s) 1436, 1764
Bbv12I GWGCWC 2 cut(s) 1515, 1823
BccI CCATC 6 cut(s) 288, 787, 862, 910, 1746, 1829
BceAI ACGGC 2 cut(s) 394, 456
BcgI CGANNNNNNTGC 2 cut(s) 1533, 1567
BciT130I CCWGG 1 cut(s) 473
BclI TGATCA 2 cut(s) 802, 970
BcnI CCSGG 2 cut(s) 382, 562
BcoDI GTCTC 3 cut(s) 235, 237, 1935
BfaI CTAG 2 cut(s) 933, 1448
BfmI CTRYAG 2 cut(s) 1126, 1260
BfrI CTTAAG 1 cut(s) 419
BglII AGATCT 1 cut(s) 1264
Bme1390I CCNGG 3 cut(s) 382, 473, 562
BmgBI CACGTC 1 cut(s) 1547
BmiI GGNNCC 4 cut(s) 1089, 1321, 1695, 1971
BmrFI CCNGG 3 cut(s) 382, 473, 562
BmsI GCATC 6 cut(s) 28, 778, 966, 1269, 1362, 1647
BpiI GAAGAC 2 cut(s) 1436, 1764
BplI GAGNNNNNCTC 4 cut(s) 113, 145, 805, 837
BpmI CTGGAG 1 cut(s) 651
BpuEI CTTGAG 1 cut(s) 131
BpuMI CCSGG 2 cut(s) 382, 562
BsaAI YACGTR 1 cut(s) 1717
BsaHI GRCGYC 3 cut(s) 237, 911, 1761
BsaI GGTCTC 1 cut(s) 237
BsaJI CCNNGG 3 cut(s) 202, 1104, 1642
Bsc4I CCNNNNNNNGG 1 cut(s) 1042
Bse3DI GCAATG 5 cut(s) 131, 213, 340, 1328, 1959
BseBI CCWGG 1 cut(s) 473
BseDI CCNNGG 3 cut(s) 202, 1104, 1642
BseGI GGATG 4 cut(s) 19, 168, 798, 1638
BseLI CCNNNNNNNGG 1 cut(s) 1042
BseMI GCAATG 5 cut(s) 131, 213, 340, 1328, 1959
BseMII CTCAG 3 cut(s) 576, 878, 1134
BseRI GAGGAG 1 cut(s) 121
BseSI GKGCMC 1 cut(s) 1324
BseYI CCCAGC 1 cut(s) 1537
BsgI GTGCAG 1 cut(s) 92
Bsh1285I CGRYCG 1 cut(s) 27
BshFI GGCC 2 cut(s) 471, 1035
BshNI GGYRCC 2 cut(s) 1087, 1319
BsiEI CGRYCG 1 cut(s) 27
BsiHKAI GWGCWC 2 cut(s) 1515, 1823
BsiSI CCGG 4 cut(s) 240, 381, 432, 562
BslFI GGGAC 1 cut(s) 1554
BslI CCNNNNNNNGG 1 cut(s) 1042
BsmAI GTCTC 3 cut(s) 235, 237, 1935
BsmBI CGTCTC 1 cut(s) 235
BsmFI GGGAC 1 cut(s) 1554
BsmI GAATGC 1 cut(s) 1590
BsnI GGCC 2 cut(s) 471, 1035
Bso31I GGTCTC 1 cut(s) 237
Bsp1286I GDGCHC 3 cut(s) 1324, 1515, 1823
Bsp1407I TGTACA 1 cut(s) 300
Bsp19I CCATGG 1 cut(s) 1642
BspACI CCGC 4 cut(s) 37, 112, 178, 789
BspANI GGCC 2 cut(s) 471, 1035
BspCNI CTCAG 3 cut(s) 577, 877, 1133
BspLI GGNNCC 4 cut(s) 1089, 1321, 1695, 1971
BspPI GGATC 2 cut(s) 1062, 1351
BspT107I GGYRCC 2 cut(s) 1087, 1319
BspTI CTTAAG 1 cut(s) 419
BspTNI GGTCTC 1 cut(s) 237
BsrDI GCAATG 5 cut(s) 131, 213, 340, 1328, 1959
BsrGI TGTACA 1 cut(s) 300
BssECI CCNNGG 3 cut(s) 202, 1104, 1642
BssNI GRCGYC 3 cut(s) 237, 911, 1761
BssSI CACGAG 1 cut(s) 1015
BssT1I CCWWGG 2 cut(s) 1104, 1642
Bst2BI CACGAG 1 cut(s) 1015
Bst2UI CCWGG 1 cut(s) 473
Bst4CI ACNGT 7 cut(s) 28, 781, 1201, 1337, 1439, 1793, 1974
Bst6I CTCTTC 1 cut(s) 1064
BstACI GRCGYC 3 cut(s) 237, 911, 1761
BstAFI CTTAAG 1 cut(s) 419
BstAUI TGTACA 1 cut(s) 300
BstBAI YACGTR 1 cut(s) 1717
BstC8I GCNNGC 3 cut(s) 387, 509, 1522
BstDEI CTNAG 4 cut(s) 585, 864, 1120, 1555
BstDSI CCRYGG 1 cut(s) 1642
BstF5I GGATG 4 cut(s) 19, 168, 798, 1638
BstHHI GCGC 3 cut(s) 431, 945, 958
BstMAI GTCTC 3 cut(s) 235, 237, 1935
BstMCI CGRYCG 1 cut(s) 27
BstMWI GCNNNNNNNGC 5 cut(s) 517, 1121, 1594, 1644, 1717
BstNI CCWGG 1 cut(s) 473
BstNSI RCATGY 2 cut(s) 1231, 1877
BstSCI CCNGG 3 cut(s) 380, 471, 560
BstSFI CTRYAG 2 cut(s) 1126, 1260
BstSLI GKGCMC 1 cut(s) 1324
BstV2I GAAGAC 2 cut(s) 1436, 1764
BstX2I RGATCY 2 cut(s) 1054, 1264
BstYI RGATCY 2 cut(s) 1054, 1264
BsuRI GGCC 2 cut(s) 471, 1035
BtgI CCRYGG 1 cut(s) 1642
BtrI CACGTC 1 cut(s) 1547
BtsCI GGATG 4 cut(s) 19, 168, 798, 1638
BtsIMutI CAGTG 4 cut(s) 980, 1197, 1444, 1571
Cac8I GCNNGC 3 cut(s) 387, 509, 1522
CfoI GCGC 3 cut(s) 431, 945, 958
CseI GACGC 1 cut(s) 245
Csp6I GTAC 2 cut(s) 4, 301
CviQI GTAC 2 cut(s) 4, 301
DdeI CTNAG 4 cut(s) 585, 864, 1120, 1555
DraIII CACNNNGTG 1 cut(s) 265
DrdI GACNNNNNNGTC 1 cut(s) 1796
DseDI GACNNNNNNGTC 1 cut(s) 1796
EaeI YGGCCR 1 cut(s) 469
Eam1104I CTCTTC 1 cut(s) 1064
EarI CTCTTC 1 cut(s) 1064
Ecl136II GAGCTC 1 cut(s) 1821
Eco130I CCWWGG 2 cut(s) 1104, 1642
Eco24I GRGCYC 1 cut(s) 1823
Eco31I GGTCTC 1 cut(s) 237
Eco32I GATATC 1 cut(s) 764
Eco53kI GAGCTC 1 cut(s) 1821
Eco57I CTGAAG 1 cut(s) 1946
EcoICRI GAGCTC 1 cut(s) 1821
EcoRI GAATTC 2 cut(s) 607, 1003
EcoRII CCWGG 1 cut(s) 471
EcoRV GATATC 1 cut(s) 764
EcoT14I CCWWGG 2 cut(s) 1104, 1642
EcoT38I GRGCYC 1 cut(s) 1823
ErhI CCWWGG 2 cut(s) 1104, 1642
Esp3I CGTCTC 1 cut(s) 235
FaqI GGGAC 1 cut(s) 1554
FauI CCCGC 2 cut(s) 44, 782
FbaI TGATCA 2 cut(s) 802, 970
FblI GTMKAC 1 cut(s) 1224
FokI GGATG 4 cut(s) 6, 155, 805, 1625
FriOI GRGCYC 1 cut(s) 1823
FspBI CTAG 2 cut(s) 933, 1448
FspI TGCGCA 1 cut(s) 957
GlaI GCGC 3 cut(s) 430, 944, 957
GsaI CCCAGC 1 cut(s) 1541
GsuI CTGGAG 1 cut(s) 651
HaeIII GGCC 2 cut(s) 471, 1035
HapII CCGG 4 cut(s) 240, 381, 432, 562
HgaI GACGC 1 cut(s) 245
HhaI GCGC 3 cut(s) 431, 945, 958
Hin1I GRCGYC 3 cut(s) 237, 911, 1761
Hin6I GCGC 3 cut(s) 429, 943, 956
HinP1I GCGC 3 cut(s) 429, 943, 956
HindIII AAGCTT 2 cut(s) 482, 651
HinfI GANTC 4 cut(s) 338, 1386, 1494, 1797
HpaII CCGG 4 cut(s) 240, 381, 432, 562
HphI GGTGA 8 cut(s) 64, 89, 175, 190, 251, 1094, 1396, 1751
Hpy166II GTNNAC 4 cut(s) 402, 705, 734, 1225
Hpy188III TCNNGA 8 cut(s) 85, 1052, 1063, 1394, 1448, 1502, 1765, 1774
Hpy8I GTNNAC 4 cut(s) 402, 705, 734, 1225
Hpy99I CGWCG 3 cut(s) 239, 916, 1548
HpyAV CCTTC 7 cut(s) 229, 446, 640, 867, 1025, 1373, 1417
HpyCH4III ACNGT 7 cut(s) 28, 781, 1201, 1337, 1439, 1793, 1974
HpyCH4IV ACGT 5 cut(s) 404, 911, 1546, 1716, 1761
HpyF10VI GCNNNNNNNGC 5 cut(s) 517, 1121, 1594, 1644, 1717
HpyF3I CTNAG 4 cut(s) 585, 864, 1120, 1555
HpySE526I ACGT 5 cut(s) 404, 911, 1546, 1716, 1761
Hsp92I GRCGYC 3 cut(s) 237, 911, 1761
HspAI GCGC 3 cut(s) 429, 943, 956
Ksp22I TGATCA 2 cut(s) 802, 970
LmnI GCTCC 4 cut(s) 134, 230, 1693, 1826
LweI GCATC 6 cut(s) 28, 778, 966, 1269, 1362, 1647
MaeI CTAG 2 cut(s) 933, 1448
MaeII ACGT 5 cut(s) 404, 911, 1546, 1716, 1761
MaeIII GTNAC 7 cut(s) 70, 138, 251, 320, 887, 1201, 1433
MboII GAAGA 4 cut(s) 1051, 1436, 1571, 1769
MfeI CAATTG 1 cut(s) 1910
MflI RGATCY 2 cut(s) 1054, 1264
MhlI GDGCHC 3 cut(s) 1324, 1515, 1823
MlsI TGGCCA 1 cut(s) 471
MluNI TGGCCA 1 cut(s) 471
MlyI GAGTC 3 cut(s) 332, 1488, 1806
MmeI TCCRAC 5 cut(s) 47, 258, 1231, 1665, 1671
Mox20I TGGCCA 1 cut(s) 471
MroXI GAANNNNTTC 1 cut(s) 398
MscI TGGCCA 1 cut(s) 471
MseI TTAA 4 cut(s) 420, 480, 525, 714
MslI CAYNNNNRTG 2 cut(s) 350, 1338
Msp20I TGGCCA 1 cut(s) 471
MspA1I CMGCKG 1 cut(s) 1681
MspCI CTTAAG 1 cut(s) 419
MspI CCGG 4 cut(s) 240, 381, 432, 562
MspR9I CCNGG 3 cut(s) 382, 473, 562
MunI CAATTG 1 cut(s) 1910
Mva1269I GAATGC 1 cut(s) 1590
MvaI CCWGG 1 cut(s) 473
MwoI GCNNNNNNNGC 5 cut(s) 517, 1121, 1594, 1644, 1717
NciI CCSGG 2 cut(s) 382, 562
NcoI CCATGG 1 cut(s) 1642
NlaIV GGNNCC 4 cut(s) 1089, 1321, 1695, 1971
NmuCI GTSAC 3 cut(s) 70, 138, 1433
NsbI TGCGCA 1 cut(s) 957
NspI RCATGY 2 cut(s) 1231, 1877
PciI ACATGT 1 cut(s) 1227
PcsI WCGNNNNNNNCGW 1 cut(s) 608
PctI GAATGC 1 cut(s) 1590
PdmI GAANNNNTTC 1 cut(s) 398
PfeI GAWTC 1 cut(s) 1386
PflFI GACNNNGTC 1 cut(s) 275
PleI GAGTC 3 cut(s) 332, 1488, 1805
PpsI GAGTC 3 cut(s) 332, 1488, 1805
Ppu21I YACGTR 1 cut(s) 1717
PscI ACATGT 1 cut(s) 1227
PshBI ATTAAT 1 cut(s) 525
Psp124BI GAGCTC 1 cut(s) 1823
Psp6I CCWGG 1 cut(s) 471
PspFI CCCAGC 1 cut(s) 1537
PspGI CCWGG 1 cut(s) 471
PspN4I GGNNCC 4 cut(s) 1089, 1321, 1695, 1971
PsuI RGATCY 2 cut(s) 1054, 1264
PsyI GACNNNGTC 1 cut(s) 275
PvuII CAGCTG 1 cut(s) 1681
RsaI GTAC 2 cut(s) 5, 302
RsaNI GTAC 2 cut(s) 4, 301
RseI CAYNNNNRTG 2 cut(s) 350, 1338
SacI GAGCTC 1 cut(s) 1823
SaqAI TTAA 4 cut(s) 420, 480, 525, 714
SchI GAGTC 3 cut(s) 332, 1488, 1806
ScrFI CCNGG 3 cut(s) 382, 473, 562
SduI GDGCHC 3 cut(s) 1324, 1515, 1823
SfaNI GCATC 6 cut(s) 28, 778, 966, 1269, 1362, 1647
SfcI CTRYAG 2 cut(s) 1126, 1260
SmiMI CAYNNNNRTG 2 cut(s) 350, 1338
SmlI CTYRAG 2 cut(s) 146, 419
SmoI CTYRAG 2 cut(s) 146, 419
SsiI CCGC 4 cut(s) 37, 112, 178, 789
SspMI CTAG 2 cut(s) 933, 1448
SstI GAGCTC 1 cut(s) 1823
StyD4I CCNGG 3 cut(s) 380, 471, 560
StyI CCWWGG 2 cut(s) 1104, 1642
TaaI ACNGT 7 cut(s) 28, 781, 1201, 1337, 1439, 1793, 1974
TaiI ACGT 5 cut(s) 407, 914, 1549, 1719, 1764
TaqI TCGA 4 cut(s) 611, 876, 914, 1905
TatI WGTACW 2 cut(s) 3, 300
TfiI GAWTC 1 cut(s) 1386
Tru1I TTAA 4 cut(s) 420, 480, 525, 714
Tru9I TTAA 4 cut(s) 420, 480, 525, 714
TscAI CASTG 4 cut(s) 987, 1204, 1444, 1578
TseFI GTSAC 3 cut(s) 70, 138, 1433
Tsp45I GTSAC 3 cut(s) 70, 138, 1433
TspDTI ATGAA 7 cut(s) 334, 455, 591, 1399, 1493, 1607, 1863
TspGWI ACGGA 2 cut(s) 217, 239
TspRI CASTG 4 cut(s) 987, 1204, 1444, 1578
Tth111I GACNNNGTC 1 cut(s) 275
Vha464I CTTAAG 1 cut(s) 419
VspI ATTAAT 1 cut(s) 525
XapI RAATTY 6 cut(s) 93, 293, 376, 607, 1003, 1850
XbaI TCTAGA 1 cut(s) 1447
XceI RCATGY 2 cut(s) 1231, 1877
XmiI GTMKAC 1 cut(s) 1224
XmnI GAANNNNTTC 1 cut(s) 398
XspI CTAG 2 cut(s) 933, 1448
ZraI GACGTC 2 cut(s) 912, 1762
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.