Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000410.1

Orthogroup ID

OG0017976

Physical Location & Seq

Genomic Coordinates Forward (+)

39386 .. 40102

Gene Structure 717 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000410.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 717 bp

atgcagacaaatgtgattttactggaaaccacttatacatgggcatatctccaagttgctttcgattatggtcttacgattgtcttgcgaaacatcaatgaagattttcacatggatcttatgattgtggaagatgggatcatgcattctgctttcactgagattggccaaagcacaacagagcagcctaaaattgatgagtacatggtaccaaattttgagggggctctttctacatggggttgttccaaacacaagaatgaaacaaagattatgttgcctgtgcttcaagttgcatgtatagtggatggtcttgtgatcttgctattccttcacaaacctgtagttgacatagcaagtcagaggaccttggtgttcactgtccctacattttctgtcattctcagagattatgctagcagaaaagcaaccatagtaatatttttggctcatgcatcttgctttgccaagtttgtgcagggaatctccacaacaccagttttatgtgatgaatgtgtagcgggacatgctctttccattcctaaacaaaagacggctcaagtgcctcagtttcctactcctagagaagataatcaaatgctgaatgaaggtataattttaactacaccatttcccaagcggttgcctcctccttgtgttctggacgaatggatggttgaagcagatatgatcattaaagcaaggcaagagaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00010 ko00680 ko01100 ko01110 ko01120 ko01130 ko01200 ko01230 ko03018 ko04066 map00010 map00680 map01100 map01110 map01120 map01130 map01200 map01230 map03018 map04066

Pfam Domains

Protein Families

Enolase_C Enolase_N

Protein Analysis

238

Amino Acids

26.8

Weight (kDa)

5.35

Isoelectric Point (pI)

45.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017976)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g30481 FvH4_1g30560 FvH4_c4g00030
pyrus_communis	pycom05g12520 pycom12g01350
rosa_chinensis	RchiOBHm_Chr7g0214251
rosa_multiflora	Rmu_sc0000410.1_g000007 Rmu_sc0001154.1_g000014
rosa_roxburghii	Rroxscaffold_4G00313870 Rroxscaffold_4G00323230 Rroxscaffold_5G00382810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	208
AccB1I	GGYRCC	1 cut(s)	208
AciI	CCGC	2 cut(s)	521, 640
AclWI	GGATC	2 cut(s)	123, 146
AcoI	YGGCCR	1 cut(s)	166
AcsI	RAATTY	1 cut(s)	214
AfaI	GTAC	2 cut(s)	203, 210
AgsI	TTSAA	2 cut(s)	290, 680
AlwI	GGATC	2 cut(s)	123, 146
AoxI	GGCC	1 cut(s)	166
ApeKI	GCWGC	1 cut(s)	184
ApoI	RAATTY	1 cut(s)	214
Asp700I	GAANNNNTTC	1 cut(s)	105
Asp718I	GGTACC	1 cut(s)	208
AspS9I	GGNCC	1 cut(s)	366
AsuNHI	GCTAGC	1 cut(s)	416
AvaII	GGWCC	1 cut(s)	366
BalI	TGGCCA	1 cut(s)	168
BanI	GGYRCC	1 cut(s)	208
BanII	GRGCYC	1 cut(s)	229
BbvI	GCAGC	1 cut(s)	196
BccI	CCATC	3 cut(s)	128, 302, 667
BceAI	ACGGC	1 cut(s)	570
BcgI	CGANNNNNNTGC	2 cut(s)	67, 101
BclI	TGATCA	1 cut(s)	690
BfaI	CTAG	2 cut(s)	417, 582
BfmI	CTRYAG	1 cut(s)	342
BisI	GCNGC	1 cut(s)	185
BlsI	GCNGC	1 cut(s)	186
Bme18I	GGWCC	1 cut(s)	366
BmgT120I	GGNCC	1 cut(s)	366
BmiI	GGNNCC	1 cut(s)	210
BmsI	GCATC	1 cut(s)	464
BmtI	GCTAGC	1 cut(s)	420
BpuEI	CTTGAG	1 cut(s)	543
BsaJI	CCNNGG	1 cut(s)	369
Bse1I	ACTGG	2 cut(s)	27, 497
BseDI	CCNNGG	1 cut(s)	369
BseGI	GGATG	2 cut(s)	313, 678
BseMII	CTCAG	3 cut(s)	150, 418, 581
BseNI	ACTGG	2 cut(s)	27, 497
BseRI	GAGGAG	1 cut(s)	639
BseXI	GCAGC	1 cut(s)	196
BsgI	GTGCAG	1 cut(s)	497
BshFI	GGCC	1 cut(s)	168
BshNI	GGYRCC	1 cut(s)	208
BslFI	GGGAC	2 cut(s)	368, 537
BsmFI	GGGAC	2 cut(s)	368, 537
BsmI	GAATGC	1 cut(s)	145
BsnI	GGCC	1 cut(s)	168
Bsp1286I	GDGCHC	1 cut(s)	229
Bsp143I	GATC	4 cut(s)	115, 138, 318, 690
BspACI	CCGC	2 cut(s)	521, 640
BspANI	GGCC	1 cut(s)	168
BspCNI	CTCAG	3 cut(s)	151, 417, 580
BspLI	GGNNCC	1 cut(s)	210
BspOI	GCTAGC	1 cut(s)	420
BspPI	GGATC	2 cut(s)	123, 146
BspT107I	GGYRCC	1 cut(s)	208
BsrI	ACTGG	2 cut(s)	27, 497
BssECI	CCNNGG	1 cut(s)	369
BssMI	GATC	4 cut(s)	115, 138, 318, 690
BssT1I	CCWWGG	1 cut(s)	369
Bst4CI	ACNGT	1 cut(s)	382
BstC8I	GCNNGC	1 cut(s)	418
BstDEI	CTNAG	3 cut(s)	159, 404, 567
BstF5I	GGATG	2 cut(s)	313, 678
BstKTI	GATC	4 cut(s)	118, 141, 321, 693
BstMBI	GATC	4 cut(s)	115, 138, 318, 690
BstMWI	GCNNNNNNNGC	1 cut(s)	527
BstNSI	RCATGY	2 cut(s)	300, 530
BstSFI	CTRYAG	1 cut(s)	342
BstV1I	GCAGC	1 cut(s)	196
BstX2I	RGATCY	1 cut(s)	115
BstYI	RGATCY	1 cut(s)	115
BsuRI	GGCC	1 cut(s)	168
BtsCI	GGATG	2 cut(s)	313, 678
BtsIMutI	CAGTG	2 cut(s)	156, 378
Cac8I	GCNNGC	1 cut(s)	418
Cfr13I	GGNCC	1 cut(s)	366
Csp6I	GTAC	2 cut(s)	202, 209
CviAII	CATG	8 cut(s)	39, 112, 142, 205, 237, 297, 452, 527
CviJI	RGCY	5 cut(s)	168, 187, 227, 449, 557
CviKI_1	RGCY	5 cut(s)	168, 187, 227, 449, 557
CviQI	GTAC	2 cut(s)	202, 209
DdeI	CTNAG	3 cut(s)	159, 404, 567
DpnI	GATC	4 cut(s)	117, 140, 320, 692
DpnII	GATC	4 cut(s)	115, 138, 318, 690
EaeI	YGGCCR	1 cut(s)	166
Eco130I	CCWWGG	1 cut(s)	369
Eco24I	GRGCYC	1 cut(s)	229
Eco47I	GGWCC	1 cut(s)	366
EcoO109I	RGGNCCY	1 cut(s)	366
EcoT14I	CCWWGG	1 cut(s)	369
EcoT22I	ATGCAT	2 cut(s)	147, 457
EcoT38I	GRGCYC	1 cut(s)	229
ErhI	CCWWGG	1 cut(s)	369
FaeI	CATG	8 cut(s)	42, 115, 145, 208, 240, 300, 455, 530
FaqI	GGGAC	2 cut(s)	368, 537
FatI	CATG	8 cut(s)	38, 111, 141, 204, 236, 296, 451, 526
FauI	CCCGC	1 cut(s)	514
FbaI	TGATCA	1 cut(s)	690
Fnu4HI	GCNGC	1 cut(s)	185
FokI	GGATG	2 cut(s)	320, 685
FriOI	GRGCYC	1 cut(s)	229
Fsp4HI	GCNGC	1 cut(s)	185
FspBI	CTAG	2 cut(s)	417, 582
GluI	GCNGC	1 cut(s)	185
HaeIII	GGCC	1 cut(s)	168
Hin1II	CATG	8 cut(s)	42, 115, 145, 208, 240, 300, 455, 530
HincII	GTYRAC	1 cut(s)	349
HindII	GTYRAC	1 cut(s)	349
HinfI	GANTC	1 cut(s)	483
Hpy166II	GTNNAC	2 cut(s)	349, 378
Hpy188I	TCNGA	2 cut(s)	363, 407
Hpy188III	TCNNGA	1 cut(s)	662
Hpy8I	GTNNAC	2 cut(s)	349, 378
HpyAV	CCTTC	2 cut(s)	341, 602
HpyCH4III	ACNGT	1 cut(s)	382
HpyCH4V	TGCA	5 cut(s)	4, 145, 296, 455, 478
HpyF10VI	GCNNNNNNNGC	1 cut(s)	527
HpyF3I	CTNAG	3 cut(s)	159, 404, 567
Hsp92II	CATG	8 cut(s)	42, 115, 145, 208, 240, 300, 455, 530
KpnI	GGTACC	1 cut(s)	212
Ksp22I	TGATCA	1 cut(s)	690
Kzo9I	GATC	4 cut(s)	115, 138, 318, 690
LpnPI	CCDG	6 cut(s)	8, 294, 354, 464, 510, 647
Lsp1109I	GCAGC	1 cut(s)	196
LweI	GCATC	1 cut(s)	464
MaeI	CTAG	2 cut(s)	417, 582
MalI	GATC	4 cut(s)	117, 140, 320, 692
MboI	GATC	4 cut(s)	115, 138, 318, 690
MboII	GAAGA	3 cut(s)	113, 143, 599
MflI	RGATCY	1 cut(s)	115
MhlI	GDGCHC	1 cut(s)	229
MlsI	TGGCCA	1 cut(s)	168
MluCI	AATT	3 cut(s)	192, 214, 615
MluNI	TGGCCA	1 cut(s)	168
MnlI	CCTC	6 cut(s)	214, 357, 576, 657, 660, 705
Mox20I	TGGCCA	1 cut(s)	168
Mph1103I	ATGCAT	2 cut(s)	147, 457
MroXI	GAANNNNTTC	1 cut(s)	105
MscI	TGGCCA	1 cut(s)	168
MseI	TTAA	2 cut(s)	620, 696
MslI	CAYNNNNRTG	1 cut(s)	258
Msp20I	TGGCCA	1 cut(s)	168
Mva1269I	GAATGC	1 cut(s)	145
MwoI	GCNNNNNNNGC	1 cut(s)	527
NdeII	GATC	4 cut(s)	115, 138, 318, 690
NheI	GCTAGC	1 cut(s)	416
NlaIII	CATG	8 cut(s)	42, 115, 145, 208, 240, 300, 455, 530
NlaIV	GGNNCC	1 cut(s)	210
NsiI	ATGCAT	2 cut(s)	147, 457
NspI	RCATGY	2 cut(s)	300, 530
PctI	GAATGC	1 cut(s)	145
PdmI	GAANNNNTTC	1 cut(s)	105
PfeI	GAWTC	1 cut(s)	483
PkrI	GCNGC	1 cut(s)	186
PpuMI	RGGWCCY	1 cut(s)	366
Psp5II	RGGWCCY	1 cut(s)	366
PspN4I	GGNNCC	1 cut(s)	210
PspPI	GGNCC	1 cut(s)	366
PspPPI	RGGWCCY	1 cut(s)	366
PsuI	RGATCY	1 cut(s)	115
RsaI	GTAC	2 cut(s)	203, 210
RsaNI	GTAC	2 cut(s)	202, 209
RseI	CAYNNNNRTG	1 cut(s)	258
SaqAI	TTAA	2 cut(s)	620, 696
SatI	GCNGC	1 cut(s)	185
Sau3AI	GATC	4 cut(s)	115, 138, 318, 690
Sau96I	GGNCC	1 cut(s)	366
SduI	GDGCHC	1 cut(s)	229
SetI	ASST	4 cut(s)	343, 371, 613, 716
SfaNI	GCATC	1 cut(s)	464
SfcI	CTRYAG	1 cut(s)	342
SinI	GGWCC	1 cut(s)	366
SmiMI	CAYNNNNRTG	1 cut(s)	258
SmlI	CTYRAG	1 cut(s)	558
SmoI	CTYRAG	1 cut(s)	558
Sse9I	AATT	3 cut(s)	192, 214, 615
SsiI	CCGC	2 cut(s)	521, 640
SspI	AATATT	1 cut(s)	441
SspMI	CTAG	2 cut(s)	417, 582
StyI	CCWWGG	1 cut(s)	369
TaaI	ACNGT	1 cut(s)	382
TaqI	TCGA	1 cut(s)	63
TasI	AATT	3 cut(s)	192, 214, 615
TatI	WGTACW	1 cut(s)	201
TfiI	GAWTC	1 cut(s)	483
Tru1I	TTAA	2 cut(s)	620, 696
Tru9I	TTAA	2 cut(s)	620, 696
TscAI	CASTG	2 cut(s)	163, 385
TseI	GCWGC	1 cut(s)	184
TspDTI	ATGAA	4 cut(s)	114, 276, 525, 621
TspRI	CASTG	2 cut(s)	163, 385
VpaK11BI	GGWCC	1 cut(s)	366
XapI	RAATTY	1 cut(s)	214
XceI	RCATGY	2 cut(s)	300, 530
XmnI	GAANNNNTTC	1 cut(s)	105
XspI	CTAG	2 cut(s)	417, 582
Zsp2I	ATGCAT	2 cut(s)	147, 457

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.