Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001154.1

Orthogroup ID

OG0017976

Physical Location & Seq

Genomic Coordinates Reverse (-)

97841 .. 100496

Gene Structure 2656 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001154.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1218 bp

atggaagatgggatcatgcattctgctttcaccgtgattggccaaagcacaacagagcagcctaaaattgatgagtatatggtgccaaattttgtgggggctctttctacatgggattgttccaaacacaagaatgaaactaagattatgttgcttgtgcttcaagttgcatatatagtggatggtcttgtgatattgctattccttcacaaacctgtagttgacatagcaagtcagaggaccttggtgttcgctgtccctacattttctgtcattctaagagattatgctagcagaaaagcaaccatagtaatatttttggctcctgcatcttgctttgccaagtttgtgcaaggaatctccacaacaccagttttatgtgatgaatgtgcagcgggacatgctctttccattcctaaacaaaagactactcaagtgcctctgtttcctactcctagagaagagaatcaaatgctgaatgcaggtataattttaactacaccatttcacaagcggttgacgactccttgtgttatggacgaatggatggttgaagcagatatgatcattaaagcaaggcaagagaggagaatggtttttgctgaagttttggctcaattcccttttcttacatgcttaaggcctgagggcatgccttattgtaaggggggaggaatgttaggactcttgttctataattacatattgtattgggctaatgtgttgagctacgtaaatgggttgtgtttccatcttgggttttacatgtatatggcttattggactcgggtcgggtcatcaagtaaatggagcacaacaagtagaagaaggttcatacctcgaatagcccagaagatcgccggaaaacttgtcggcgtcaaagacagtgacggggccaaagcaaccccaaaaccaaagtcagtcaaaatcgatcgaattgaaaagctaaaagagaacgatgccggtacgccgtcttgggggggccggacgccagagttgcctgaacttgcccagaaaccgtcagaggatcatgaactttgggccttcgactctctttctacagccagtgcatggatgatccgagaccaccaacaggtcgacgatgaagagacgcttcgattgatggagcgtctatcttatgcagctgagcaggaatctctctgtcgcaggccagctttagcgactcggtttggtgtccatcgccggagactagagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

405

Amino Acids

45.78

Weight (kDa)

8.74

Isoelectric Point (pI)

51.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017976)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g30481 FvH4_1g30560 FvH4_c4g00030
pyrus_communis	pycom05g12520 pycom12g01350
rosa_chinensis	RchiOBHm_Chr7g0214251
rosa_multiflora	Rmu_sc0000410.1_g000007 Rmu_sc0001154.1_g000014
rosa_roxburghii	Rroxscaffold_4G00313870 Rroxscaffold_4G00323230 Rroxscaffold_5G00382810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	473
AccB1I	GGYRCC	1 cut(s)	82
AccB7I	CCANNNNNTGG	1 cut(s)	1071
AccI	GTMKAC	1 cut(s)	1098
AciI	CCGC	2 cut(s)	395, 514
AclWI	GGATC	3 cut(s)	20, 1035, 1072
AcoI	YGGCCR	1 cut(s)	40
AcsI	RAATTY	1 cut(s)	88
AcuI	CTGAAG	1 cut(s)	624
AcyI	GRCGYC	2 cut(s)	876, 989
AfaI	GTAC	1 cut(s)	967
AfiI	CCNNNNNNNGG	3 cut(s)	977, 1071, 1093
AflII	CTTAAG	1 cut(s)	637
AflIII	ACRYGT	1 cut(s)	765
AgsI	TTSAA	3 cut(s)	164, 554, 941
AluBI	AGCT	4 cut(s)	729, 946, 1145, 1175
AluI	AGCT	4 cut(s)	729, 946, 1145, 1175
Alw21I	GWGCWC	1 cut(s)	815
Alw26I	GTCTC	3 cut(s)	1077, 1103, 1201
AlwI	GGATC	3 cut(s)	20, 1035, 1072
Ama87I	CYCGRG	1 cut(s)	786
AoxI	GGCC	6 cut(s)	40, 641, 894, 982, 1041, 1169
ApeKI	GCWGC	3 cut(s)	58, 392, 1142
ApoI	RAATTY	1 cut(s)	88
ArsI	GACNNNNNNTTYG	2 cut(s)	902, 934
AspS9I	GGNCC	4 cut(s)	240, 894, 982, 1041
AsuHPI	GGTGA	1 cut(s)	22
AsuNHI	GCTAGC	1 cut(s)	290
AvaI	CYCGRG	1 cut(s)	786
AvaII	GGWCC	1 cut(s)	240
AxyI	CCTNAGG	1 cut(s)	645
BalI	TGGCCA	1 cut(s)	42
BanI	GGYRCC	1 cut(s)	82
BanII	GRGCYC	1 cut(s)	103
Bbv12I	GWGCWC	1 cut(s)	815
BbvI	GCAGC	3 cut(s)	70, 404, 1154
BccI	CCATC	6 cut(s)	2, 176, 541, 759, 1117, 1206
BceAI	ACGGC	1 cut(s)	955
BclI	TGATCA	1 cut(s)	564
BcoDI	GTCTC	3 cut(s)	1077, 1103, 1201
BfaI	CTAG	3 cut(s)	291, 456, 1211
BfmI	CTRYAG	2 cut(s)	216, 1059
BfrI	CTTAAG	1 cut(s)	637
BfuAI	ACCTGC	1 cut(s)	473
BisI	GCNGC	3 cut(s)	59, 393, 1143
BlpI	GCTNAGC	1 cut(s)	1146
BlsI	GCNGC	3 cut(s)	60, 394, 1144
Bme18I	GGWCC	1 cut(s)	240
BmeT110I	CYCGRG	1 cut(s)	786
BmgT120I	GGNCC	4 cut(s)	240, 894, 982, 1041
BmiI	GGNNCC	4 cut(s)	84, 324, 895, 983
BmsI	GCATC	2 cut(s)	338, 949
BmtI	GCTAGC	1 cut(s)	294
BoxI	GACNNNNGTC	1 cut(s)	788
Bpu1102I	GCTNAGC	1 cut(s)	1146
BpuEI	CTTGAG	1 cut(s)	417
Bsa29I	ATCGAT	1 cut(s)	930
BsaAI	YACGTR	1 cut(s)	733
BsaHI	GRCGYC	2 cut(s)	876, 989
BsaI	GGTCTC	1 cut(s)	1077
BsaJI	CCNNGG	1 cut(s)	243
Bsc4I	CCNNNNNNNGG	3 cut(s)	977, 1071, 1093
Bse118I	RCCGGY	1 cut(s)	962
Bse1I	ACTGG	2 cut(s)	371, 1065
Bse21I	CCTNAGG	1 cut(s)	645
BseCI	ATCGAT	1 cut(s)	930
BseDI	CCNNGG	1 cut(s)	243
BseGI	GGATG	3 cut(s)	187, 552, 1080
BseLI	CCNNNNNNNGG	3 cut(s)	977, 1071, 1093
BseMII	CTCAG	2 cut(s)	636, 1137
BseNI	ACTGG	2 cut(s)	371, 1065
BseRI	GAGGAG	1 cut(s)	601
BseXI	GCAGC	3 cut(s)	70, 404, 1154
BsgI	GTGCAG	1 cut(s)	411
Bsh1285I	CGRYCG	1 cut(s)	934
BshFI	GGCC	6 cut(s)	42, 643, 896, 984, 1043, 1171
BshNI	GGYRCC	1 cut(s)	82
BshVI	ATCGAT	1 cut(s)	930
BsiEI	CGRYCG	1 cut(s)	934
BsiHKAI	GWGCWC	1 cut(s)	815
BsiHKCI	CYCGRG	1 cut(s)	786
BsiSI	CCGG	4 cut(s)	861, 963, 985, 1204
BslFI	GGGAC	2 cut(s)	242, 411
BslI	CCNNNNNNNGG	3 cut(s)	977, 1071, 1093
BsmAI	GTCTC	3 cut(s)	1077, 1103, 1201
BsmBI	CGTCTC	1 cut(s)	1103
BsmFI	GGGAC	2 cut(s)	242, 411
BsmI	GAATGC	2 cut(s)	19, 484
BsnI	GGCC	6 cut(s)	42, 643, 896, 984, 1043, 1171
Bso31I	GGTCTC	1 cut(s)	1077
BsoBI	CYCGRG	1 cut(s)	786
Bsp1286I	GDGCHC	2 cut(s)	103, 815
Bsp143I	GATC	6 cut(s)	12, 564, 855, 931, 1027, 1077
Bsp1720I	GCTNAGC	1 cut(s)	1146
BspACI	CCGC	2 cut(s)	395, 514
BspANI	GGCC	6 cut(s)	42, 643, 896, 984, 1043, 1171
BspCNI	CTCAG	2 cut(s)	637, 1138
BspDI	ATCGAT	1 cut(s)	930
BspHI	TCATGA	1 cut(s)	1030
BspLI	GGNNCC	4 cut(s)	84, 324, 895, 983
BspMI	ACCTGC	1 cut(s)	473
BspOI	GCTAGC	1 cut(s)	294
BspPI	GGATC	3 cut(s)	20, 1035, 1072
BspT107I	GGYRCC	1 cut(s)	82
BspTI	CTTAAG	1 cut(s)	637
BspTNI	GGTCTC	1 cut(s)	1077
BsrFI	RCCGGY	1 cut(s)	962
BsrI	ACTGG	2 cut(s)	371, 1065
BssAI	RCCGGY	1 cut(s)	962
BssECI	CCNNGG	1 cut(s)	243
BssMI	GATC	6 cut(s)	12, 564, 855, 931, 1027, 1077
BssNI	GRCGYC	2 cut(s)	876, 989
BssT1I	CCWWGG	1 cut(s)	243
Bst4CI	ACNGT	3 cut(s)	34, 887, 1020
Bst6I	CTCTTC	2 cut(s)	456, 1101
BstACI	GRCGYC	2 cut(s)	876, 989
BstAFI	CTTAAG	1 cut(s)	637
BstBAI	YACGTR	1 cut(s)	733
BstC8I	GCNNGC	4 cut(s)	292, 653, 1169, 1173
BstDEI	CTNAG	4 cut(s)	141, 278, 645, 1146
BstF5I	GGATG	3 cut(s)	187, 552, 1080
BstKTI	GATC	6 cut(s)	15, 567, 858, 934, 1030, 1080
BstMAI	GTCTC	3 cut(s)	1077, 1103, 1201
BstMBI	GATC	6 cut(s)	12, 564, 855, 931, 1027, 1077
BstMCI	CGRYCG	1 cut(s)	934
BstMWI	GCNNNNNNNGC	2 cut(s)	401, 997
BstNSI	RCATGY	4 cut(s)	404, 636, 655, 769
BstPAI	GACNNNNGTC	1 cut(s)	788
BstSFI	CTRYAG	2 cut(s)	216, 1059
BstSNI	TACGTA	1 cut(s)	733
BstV1I	GCAGC	3 cut(s)	70, 404, 1154
Bsu15I	ATCGAT	1 cut(s)	930
Bsu36I	CCTNAGG	1 cut(s)	645
BsuRI	GGCC	6 cut(s)	42, 643, 896, 984, 1043, 1171
BsuTUI	ATCGAT	1 cut(s)	930
BtgZI	GCGATG	1 cut(s)	1184
BtsCI	GGATG	3 cut(s)	187, 552, 1080
BtsIMutI	CAGTG	2 cut(s)	892, 1072
BveI	ACCTGC	1 cut(s)	473
Cac8I	GCNNGC	4 cut(s)	292, 653, 1169, 1173
CciI	TCATGA	1 cut(s)	1030
Cfr10I	RCCGGY	1 cut(s)	962
Cfr13I	GGNCC	4 cut(s)	240, 894, 982, 1041
ClaI	ATCGAT	1 cut(s)	930
CseI	GACGC	4 cut(s)	865, 997, 1118, 1120
Csp6I	GTAC	1 cut(s)	966
CspCI	CAANNNNNGTGG	2 cut(s)	75, 110
CviAII	CATG	8 cut(s)	16, 111, 401, 633, 652, 766, 1031, 1071
CviQI	GTAC	1 cut(s)	966
DdeI	CTNAG	4 cut(s)	141, 278, 645, 1146
DpnI	GATC	6 cut(s)	14, 566, 857, 933, 1029, 1079
DpnII	GATC	6 cut(s)	12, 564, 855, 931, 1027, 1077
EaeI	YGGCCR	1 cut(s)	40
Eam1104I	CTCTTC	2 cut(s)	456, 1101
EarI	CTCTTC	2 cut(s)	456, 1101
Eco105I	TACGTA	1 cut(s)	733
Eco130I	CCWWGG	1 cut(s)	243
Eco147I	AGGCCT	1 cut(s)	643
Eco24I	GRGCYC	1 cut(s)	103
Eco31I	GGTCTC	1 cut(s)	1077
Eco47I	GGWCC	1 cut(s)	240
Eco57I	CTGAAG	1 cut(s)	624
Eco81I	CCTNAGG	1 cut(s)	645
Eco88I	CYCGRG	1 cut(s)	786
EcoO109I	RGGNCCY	1 cut(s)	240
EcoT14I	CCWWGG	1 cut(s)	243
EcoT22I	ATGCAT	1 cut(s)	21
EcoT38I	GRGCYC	1 cut(s)	103
ErhI	CCWWGG	1 cut(s)	243
Esp3I	CGTCTC	1 cut(s)	1103
FaeI	CATG	8 cut(s)	19, 114, 404, 636, 655, 769, 1034, 1074
FalI	AAGNNNNNCTT	2 cut(s)	1098, 1130
FaqI	GGGAC	2 cut(s)	242, 411
FatI	CATG	8 cut(s)	15, 110, 400, 632, 651, 765, 1030, 1070
FauI	CCCGC	1 cut(s)	388
FbaI	TGATCA	1 cut(s)	564
FblI	GTMKAC	1 cut(s)	1098
Fnu4HI	GCNGC	3 cut(s)	59, 393, 1143
FokI	GGATG	3 cut(s)	194, 559, 1087
FriOI	GRGCYC	1 cut(s)	103
Fsp4HI	GCNGC	3 cut(s)	59, 393, 1143
FspBI	CTAG	3 cut(s)	291, 456, 1211
GluI	GCNGC	3 cut(s)	59, 393, 1143
HaeIII	GGCC	6 cut(s)	42, 643, 896, 984, 1043, 1171
HapII	CCGG	4 cut(s)	861, 963, 985, 1204
HgaI	GACGC	4 cut(s)	865, 997, 1118, 1120
Hin1I	GRCGYC	2 cut(s)	876, 989
Hin1II	CATG	8 cut(s)	19, 114, 404, 636, 655, 769, 1034, 1074
HincII	GTYRAC	3 cut(s)	223, 519, 1099
HindII	GTYRAC	3 cut(s)	223, 519, 1099
HinfI	GANTC	8 cut(s)	357, 466, 523, 684, 784, 1049, 1154, 1183
HpaII	CCGG	4 cut(s)	861, 963, 985, 1204
HphI	GGTGA	1 cut(s)	22
Hpy166II	GTNNAC	3 cut(s)	223, 519, 1099
Hpy188I	TCNGA	3 cut(s)	237, 1024, 1082
Hpy188III	TCNNGA	1 cut(s)	1031
Hpy8I	GTNNAC	3 cut(s)	223, 519, 1099
Hpy99I	CGWCG	1 cut(s)	1103
HpyAV	CCTTC	3 cut(s)	215, 822, 1054
HpyCH4III	ACNGT	3 cut(s)	34, 887, 1020
HpyCH4IV	ACGT	1 cut(s)	732
HpyCH4V	TGCA	8 cut(s)	19, 170, 329, 352, 392, 482, 1070, 1142
HpyF10VI	GCNNNNNNNGC	2 cut(s)	401, 997
HpyF3I	CTNAG	4 cut(s)	141, 278, 645, 1146
HpySE526I	ACGT	1 cut(s)	732
Hsp92I	GRCGYC	2 cut(s)	876, 989
Hsp92II	CATG	8 cut(s)	19, 114, 404, 636, 655, 769, 1034, 1074
Ksp22I	TGATCA	1 cut(s)	564
Kzo9I	GATC	6 cut(s)	12, 564, 855, 931, 1027, 1077
LmnI	GCTCC	3 cut(s)	328, 810, 1126
Lsp1109I	GCAGC	3 cut(s)	70, 404, 1154
LweI	GCATC	2 cut(s)	338, 949
MaeI	CTAG	3 cut(s)	291, 456, 1211
MaeII	ACGT	1 cut(s)	732
MaeIII	GTNAC	1 cut(s)	887
MalI	GATC	6 cut(s)	14, 566, 857, 933, 1029, 1079
MboI	GATC	6 cut(s)	12, 564, 855, 931, 1027, 1077
MboII	GAAGA	5 cut(s)	17, 473, 837, 865, 1118
MhlI	GDGCHC	2 cut(s)	103, 815
MlsI	TGGCCA	1 cut(s)	42
MluCI	AATT	6 cut(s)	66, 88, 489, 617, 697, 936
MluNI	TGGCCA	1 cut(s)	42
MlyI	GAGTC	5 cut(s)	517, 678, 778, 1043, 1177
MnlI	CCTC	7 cut(s)	231, 450, 579, 640, 665, 849, 1018
Mox20I	TGGCCA	1 cut(s)	42
Mph1103I	ATGCAT	1 cut(s)	21
MscI	TGGCCA	1 cut(s)	42
MseI	TTAA	3 cut(s)	494, 570, 638
MslI	CAYNNNNRTG	2 cut(s)	132, 770
Msp20I	TGGCCA	1 cut(s)	42
MspA1I	CMGCKG	2 cut(s)	395, 1145
MspCI	CTTAAG	1 cut(s)	637
MspI	CCGG	4 cut(s)	861, 963, 985, 1204
Mva1269I	GAATGC	2 cut(s)	19, 484
MwoI	GCNNNNNNNGC	2 cut(s)	401, 997
NdeII	GATC	6 cut(s)	12, 564, 855, 931, 1027, 1077
NheI	GCTAGC	1 cut(s)	290
NlaIII	CATG	8 cut(s)	19, 114, 404, 636, 655, 769, 1034, 1074
NlaIV	GGNNCC	4 cut(s)	84, 324, 895, 983
NmuCI	GTSAC	1 cut(s)	887
NsiI	ATGCAT	1 cut(s)	21
NspI	RCATGY	4 cut(s)	404, 636, 655, 769
PaeI	GCATGC	1 cut(s)	655
PagI	TCATGA	1 cut(s)	1030
PceI	AGGCCT	1 cut(s)	643
PciI	ACATGT	1 cut(s)	765
PctI	GAATGC	2 cut(s)	19, 484
PfeI	GAWTC	3 cut(s)	357, 466, 1154
PflMI	CCANNNNNTGG	1 cut(s)	1071
PkrI	GCNGC	3 cut(s)	60, 394, 1144
Ple19I	CGATCG	1 cut(s)	934
PleI	GAGTC	5 cut(s)	517, 678, 778, 1043, 1177
PpsI	GAGTC	5 cut(s)	517, 678, 778, 1043, 1177
Ppu21I	YACGTR	1 cut(s)	733
PpuMI	RGGWCCY	1 cut(s)	240
PscI	ACATGT	1 cut(s)	765
PshAI	GACNNNNGTC	1 cut(s)	788
Psp5II	RGGWCCY	1 cut(s)	240
PspN4I	GGNNCC	4 cut(s)	84, 324, 895, 983
PspPI	GGNCC	4 cut(s)	240, 894, 982, 1041
PspPPI	RGGWCCY	1 cut(s)	240
PvuI	CGATCG	1 cut(s)	934
PvuII	CAGCTG	1 cut(s)	1145
RsaI	GTAC	1 cut(s)	967
RsaNI	GTAC	1 cut(s)	966
RseI	CAYNNNNRTG	2 cut(s)	132, 770
SalI	GTCGAC	1 cut(s)	1097
SaqAI	TTAA	3 cut(s)	494, 570, 638
SatI	GCNGC	3 cut(s)	59, 393, 1143
Sau3AI	GATC	6 cut(s)	12, 564, 855, 931, 1027, 1077
Sau96I	GGNCC	4 cut(s)	240, 894, 982, 1041
SchI	GAGTC	5 cut(s)	517, 678, 778, 1043, 1177
SduI	GDGCHC	2 cut(s)	103, 815
SfaNI	GCATC	2 cut(s)	338, 949
SfcI	CTRYAG	2 cut(s)	216, 1059
SinI	GGWCC	1 cut(s)	240
SmiMI	CAYNNNNRTG	2 cut(s)	132, 770
SmlI	CTYRAG	2 cut(s)	432, 637
SmoI	CTYRAG	2 cut(s)	432, 637
SnaBI	TACGTA	1 cut(s)	733
SphI	GCATGC	1 cut(s)	655
Sse9I	AATT	6 cut(s)	66, 88, 489, 617, 697, 936
SseBI	AGGCCT	1 cut(s)	643
SsiI	CCGC	2 cut(s)	395, 514
SspI	AATATT	1 cut(s)	315
SspMI	CTAG	3 cut(s)	291, 456, 1211
StuI	AGGCCT	1 cut(s)	643
StyI	CCWWGG	1 cut(s)	243
TaaI	ACNGT	3 cut(s)	34, 887, 1020
TaiI	ACGT	1 cut(s)	735
TaqI	TCGA	6 cut(s)	841, 930, 934, 1047, 1098, 1117
TasI	AATT	6 cut(s)	66, 88, 489, 617, 697, 936
TfiI	GAWTC	3 cut(s)	357, 466, 1154
Tru1I	TTAA	3 cut(s)	494, 570, 638
Tru9I	TTAA	3 cut(s)	494, 570, 638
TscAI	CASTG	2 cut(s)	892, 1072
TseFI	GTSAC	1 cut(s)	887
TseI	GCWGC	3 cut(s)	58, 392, 1142
Tsp45I	GTSAC	1 cut(s)	887
TspDTI	ATGAA	5 cut(s)	150, 399, 823, 1047, 1119
TspRI	CASTG	2 cut(s)	892, 1072
Van91I	CCANNNNNTGG	1 cut(s)	1071
Vha464I	CTTAAG	1 cut(s)	637
VpaK11BI	GGWCC	1 cut(s)	240
XapI	RAATTY	1 cut(s)	88
XceI	RCATGY	4 cut(s)	404, 636, 655, 769
XmiI	GTMKAC	1 cut(s)	1098
XspI	CTAG	3 cut(s)	291, 456, 1211
Zsp2I	ATGCAT	1 cut(s)	21

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.