Rmu_sc0000455.1_g000014

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000455.1
OG0016960
Physical Location & Seq
Reverse (-)
62126 .. 66880
4755 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 636 bp
atgaacacaagtcttgttcggccacgctcgtcacacgacgacgaggctagagaccaacatgcagagaagggtagggctcgaaggtggactggacggagctatgtggggccagaggacgtgcagcctagcattgactcgtcggaggaaggcaaagaagatggtggctccagtgaatctctgaaaaacaatagtttcagtgggccaattccgccttccattggtaatctggccgatcttacttttatagacctatctgacaacaagcttcagggatccatcccagtctctaatgggactacacttggtcttgataagttacttaaggcgagacgctttgatagaagaacaatgttcgatctccatcaaataagtgaggcaaaagcattgcttgcttcactagatgagagctccgaagaattggcttttatcattgatgagaattcacttgcttacgccttagagggccttctatcagatgacactgcaattgctgttaagaagctttctgccaaatcaaagcaagggaatcatgaatttgtgaatgagattggcatgatttctgctctgcaacacccttaccttgtcaagctttatggatgttgtattgaaggaaatgacttgttgcttgtctattag

Protein Analysis

211

Amino Acids

23.11

Weight (kDa)

4.98

Isoelectric Point (pI)

46.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 159 - 210 1.7e-07 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 209
AclWI GGATC 2 cut(s) 267, 280
AcoI YGGCCR 2 cut(s) 20, 228
AcsI RAATTY 2 cut(s) 439, 533
AcuI CTGAAG 1 cut(s) 251
AfiI CCNNNNNNNGG 1 cut(s) 218
AflII CTTAAG 1 cut(s) 320
AgsI TTSAA 1 cut(s) 608
AjiI CACGTC 1 cut(s) 118
AjuI GAANNNNNNNTTGG 2 cut(s) 196, 228
AluBI AGCT 5 cut(s) 99, 265, 408, 502, 589
AluI AGCT 5 cut(s) 99, 265, 408, 502, 589
Alw21I GWGCWC 1 cut(s) 410
Alw26I GTCTC 3 cut(s) 45, 289, 322
AlwI GGATC 2 cut(s) 267, 280
AoxI GGCC 5 cut(s) 20, 107, 200, 228, 463
ApeKI GCWGC 1 cut(s) 121
ApoI RAATTY 2 cut(s) 439, 533
AspS9I GGNCC 3 cut(s) 107, 200, 463
BamHI GGATCC 1 cut(s) 272
BanII GRGCYC 2 cut(s) 79, 410
Bbv12I GWGCWC 1 cut(s) 410
BbvI GCAGC 1 cut(s) 133
BccI CCATC 3 cut(s) 152, 284, 369
BcoDI GTCTC 3 cut(s) 45, 289, 322
BfaI CTAG 3 cut(s) 48, 126, 398
BfrI CTTAAG 1 cut(s) 320
BisI GCNGC 1 cut(s) 122
BlsI GCNGC 1 cut(s) 123
BmgBI CACGTC 1 cut(s) 118
BmgT120I GGNCC 3 cut(s) 107, 200, 463
BmiI GGNNCC 3 cut(s) 108, 166, 274
BmrI ACTGGG 1 cut(s) 275
BmuI ACTGGG 1 cut(s) 275
BpmI CTGGAG 1 cut(s) 151
BsaBI GATNNNNATC 1 cut(s) 360
BsaI GGTCTC 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 218
Bse1I ACTGG 3 cut(s) 94, 168, 281
Bse3DI GCAATG 1 cut(s) 383
Bse8I GATNNNNATC 1 cut(s) 360
BseGI GGATG 2 cut(s) 276, 602
BseJI GATNNNNATC 1 cut(s) 360
BseLI CCNNNNNNNGG 1 cut(s) 218
BseMI GCAATG 1 cut(s) 383
BseNI ACTGG 3 cut(s) 94, 168, 281
BseXI GCAGC 1 cut(s) 133
BsgI GTGCAG 1 cut(s) 140
BshFI GGCC 5 cut(s) 22, 109, 202, 230, 465
BsiHKAI GWGCWC 1 cut(s) 410
BslFI GGGAC 1 cut(s) 307
BslI CCNNNNNNNGG 1 cut(s) 218
BsmAI GTCTC 3 cut(s) 45, 289, 322
BsmBI CGTCTC 1 cut(s) 322
BsmFI GGGAC 1 cut(s) 307
BsnI GGCC 5 cut(s) 22, 109, 202, 230, 465
Bso31I GGTCTC 1 cut(s) 45
Bsp1286I GDGCHC 2 cut(s) 79, 410
Bsp143I GATC 3 cut(s) 232, 272, 355
BspACI CCGC 1 cut(s) 209
BspANI GGCC 5 cut(s) 22, 109, 202, 230, 465
BspHI TCATGA 1 cut(s) 529
BspLI GGNNCC 3 cut(s) 108, 166, 274
BspPI GGATC 2 cut(s) 267, 280
BspTI CTTAAG 1 cut(s) 320
BspTNI GGTCTC 1 cut(s) 45
BsrDI GCAATG 1 cut(s) 383
BsrI ACTGG 3 cut(s) 94, 168, 281
BssMI GATC 3 cut(s) 232, 272, 355
BstAFI CTTAAG 1 cut(s) 320
BstAPI GCANNNNNTGC 1 cut(s) 389
BstC8I GCNNGC 1 cut(s) 390
BstDEI CTNAG 1 cut(s) 457
BstF5I GGATG 2 cut(s) 276, 602
BstKTI GATC 3 cut(s) 235, 275, 358
BstMAI GTCTC 3 cut(s) 45, 289, 322
BstMBI GATC 3 cut(s) 232, 272, 355
BstMWI GCNNNNNNNGC 2 cut(s) 208, 389
BstNSI RCATGY 1 cut(s) 62
BstV1I GCAGC 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 272
BstYI RGATCY 1 cut(s) 272
BsuRI GGCC 5 cut(s) 22, 109, 202, 230, 465
BtrI CACGTC 1 cut(s) 118
BtsCI GGATG 2 cut(s) 276, 602
BtsI GCAGTG 1 cut(s) 480
BtsIMutI CAGTG 3 cut(s) 175, 202, 480
Cac8I GCNNGC 1 cut(s) 390
CciI TCATGA 1 cut(s) 529
Cfr13I GGNCC 3 cut(s) 107, 200, 463
CseI GACGC 1 cut(s) 339
CviAII CATG 3 cut(s) 59, 530, 553
DdeI CTNAG 1 cut(s) 457
DpnI GATC 3 cut(s) 234, 274, 357
DpnII GATC 3 cut(s) 232, 272, 355
EaeI YGGCCR 2 cut(s) 20, 228
EciI GGCGGA 1 cut(s) 198
Ecl136II GAGCTC 1 cut(s) 408
Eco24I GRGCYC 2 cut(s) 79, 410
Eco31I GGTCTC 1 cut(s) 45
Eco53kI GAGCTC 1 cut(s) 408
Eco57I CTGAAG 1 cut(s) 251
EcoICRI GAGCTC 1 cut(s) 408
EcoO109I RGGNCCY 1 cut(s) 463
EcoRI GAATTC 1 cut(s) 439
EcoT38I GRGCYC 2 cut(s) 79, 410
Esp3I CGTCTC 1 cut(s) 322
FaeI CATG 3 cut(s) 62, 533, 556
FaiI YATR 6 cut(s) 60, 102, 245, 531, 554, 594
FalI AAGNNNNNCTT 2 cut(s) 372, 404
FaqI GGGAC 1 cut(s) 307
FatI CATG 3 cut(s) 58, 529, 552
Fnu4HI GCNGC 1 cut(s) 122
FokI GGATG 2 cut(s) 263, 609
FriOI GRGCYC 2 cut(s) 79, 410
Fsp4HI GCNGC 1 cut(s) 122
FspBI CTAG 3 cut(s) 48, 126, 398
GluI GCNGC 1 cut(s) 122
GsuI CTGGAG 1 cut(s) 151
HaeIII GGCC 5 cut(s) 22, 109, 202, 230, 465
HgaI GACGC 1 cut(s) 339
Hin1II CATG 3 cut(s) 62, 533, 556
HindIII AAGCTT 3 cut(s) 263, 500, 587
HinfI GANTC 3 cut(s) 134, 173, 526
Hpy166II GTNNAC 1 cut(s) 87
Hpy188I TCNGA 5 cut(s) 142, 180, 256, 412, 475
Hpy188III TCNNGA 2 cut(s) 308, 530
Hpy8I GTNNAC 1 cut(s) 87
Hpy99I CGWCG 3 cut(s) 41, 44, 142
HpyAV CCTTC 6 cut(s) 61, 75, 140, 222, 476, 602
HpyCH4IV ACGT 1 cut(s) 117
HpyCH4V TGCA 4 cut(s) 62, 121, 485, 568
HpyF10VI GCNNNNNNNGC 2 cut(s) 208, 389
HpyF3I CTNAG 1 cut(s) 457
HpySE526I ACGT 1 cut(s) 117
Hsp92II CATG 3 cut(s) 62, 533, 556
Kzo9I GATC 3 cut(s) 232, 272, 355
LmnI GCTCC 3 cut(s) 96, 170, 413
LpnPI CCDG 6 cut(s) 75, 123, 181, 212, 254, 294
Lsp1109I GCAGC 1 cut(s) 133
MaeI CTAG 3 cut(s) 48, 126, 398
MaeII ACGT 1 cut(s) 117
MaeIII GTNAC 2 cut(s) 30, 315
MalI GATC 3 cut(s) 234, 274, 357
MboI GATC 3 cut(s) 232, 272, 355
MboII GAAGA 3 cut(s) 167, 354, 425
MfeI CAATTG 1 cut(s) 486
MflI RGATCY 1 cut(s) 272
MhlI GDGCHC 2 cut(s) 79, 410
MluCI AATT 5 cut(s) 204, 416, 439, 486, 533
MlyI GAGTC 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 120
MnlI CCTC 5 cut(s) 37, 106, 136, 367, 454
MseI TTAA 2 cut(s) 321, 495
MspCI CTTAAG 1 cut(s) 320
MunI CAATTG 1 cut(s) 486
MwoI GCNNNNNNNGC 2 cut(s) 208, 389
NdeII GATC 3 cut(s) 232, 272, 355
NlaIII CATG 3 cut(s) 62, 533, 556
NlaIV GGNNCC 3 cut(s) 108, 166, 274
NmuCI GTSAC 1 cut(s) 30
NspI RCATGY 1 cut(s) 62
PagI TCATGA 1 cut(s) 529
PfeI GAWTC 2 cut(s) 173, 526
PkrI GCNGC 1 cut(s) 123
PleI GAGTC 1 cut(s) 128
PpsI GAGTC 1 cut(s) 128
Psp124BI GAGCTC 1 cut(s) 410
PspN4I GGNNCC 3 cut(s) 108, 166, 274
PspPI GGNCC 3 cut(s) 107, 200, 463
PsuI RGATCY 1 cut(s) 272
SacI GAGCTC 1 cut(s) 410
SaqAI TTAA 2 cut(s) 321, 495
SatI GCNGC 1 cut(s) 122
Sau3AI GATC 3 cut(s) 232, 272, 355
Sau96I GGNCC 3 cut(s) 107, 200, 463
SchI GAGTC 1 cut(s) 128
SduI GDGCHC 2 cut(s) 79, 410
SetI ASST 9 cut(s) 86, 101, 120, 252, 267, 410, 504, 582, 591
SmlI CTYRAG 1 cut(s) 320
SmoI CTYRAG 1 cut(s) 320
Sse9I AATT 5 cut(s) 204, 416, 439, 486, 533
SsiI CCGC 1 cut(s) 209
SspMI CTAG 3 cut(s) 48, 126, 398
SstI GAGCTC 1 cut(s) 410
TaiI ACGT 1 cut(s) 120
TaqI TCGA 2 cut(s) 79, 354
TasI AATT 5 cut(s) 204, 416, 439, 486, 533
TfiI GAWTC 2 cut(s) 173, 526
Tru1I TTAA 2 cut(s) 321, 495
Tru9I TTAA 2 cut(s) 321, 495
TscAI CASTG 3 cut(s) 175, 202, 487
TseFI GTSAC 1 cut(s) 30
TseI GCWGC 1 cut(s) 121
Tsp45I GTSAC 1 cut(s) 30
TspDTI ATGAA 2 cut(s) 17, 546
TspGWI ACGGA 1 cut(s) 109
TspRI CASTG 3 cut(s) 175, 202, 487
Vha464I CTTAAG 1 cut(s) 320
XapI RAATTY 2 cut(s) 439, 533
XceI RCATGY 1 cut(s) 62
XcmI CCANNNNNNNNNTGG 1 cut(s) 223
XspI CTAG 3 cut(s) 48, 126, 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.