Rmu_sc0000614.1_g000003

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000614.1
OG0018522
Physical Location & Seq
Reverse (-)
14956 .. 15807
852 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000614.1_g000003.1.cds

Sequence Viewer

Length: 852 bp
atgactatatctgaagactacaaggttaatttgttgaaccctttggatcatcatcgcgctcaaatcaagctaccagatattaacatggttaaaactagtgttaaagggattaactctggactgaggaggtatgaccatatgattaccaagtttgtcttatcgtcgaaccctttttcgtcaccggaatgcttagttctggtaagttattatgagactgccagtggttgggggttttgcagactaggagaagatacatggacgtacgtagcctggactccaatactcgatttaatttatcacaacgggcagttttatgcgatggattttagtggcaaaatcttggtttgtgatgttgaagacccaaagcaaccaaagacaactattttgctatcaaagaagataccaatggtacctatgtatgggcagactactagtcaaagcttgtacatggtagaatcagcaggggccttgttggtggttctgcaatctaggccaagaattggatcaattgaaaccaccaggtttaaggtatttgaggtgccgttcggtagagaccaggggtgggagtggtcagatttggaggtaaagaatttggagaatagaagtctattcttgggatgtgaaagttcttcattctctgttgatggctcggactacttctctgcaggatgcaaagccaattgcatatacttcaacactaaatggtgggagtggctttcaattccaaattcaaactttgctccggctgtttttatctttaacatggaagatgaaaaggtggagcaactttcagtacctaatattttagaagccccactacatatttcatggatacaaataatgcgactataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box

Protein Analysis

283

Amino Acids

32.36

Weight (kDa)

5.44

Isoelectric Point (pI)

43.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018522)

Species Orthologous Gene IDs
prunus_persica Prupe.6G285400_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0284411 RchiOBHm_Chr6g0284431
rosa_laevigata RLG00000012746 RLG00000024920
rosa_multiflora Rmu_sc0000614.1_g000003 Rmu_sc0004274.1_g000001
rosa_roxburghii Rroxscaffold_1G00014080 Rroxscaffold_6G00418520
rosa_rugosa Rorug03G0051900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 409
AccB1I GGYRCC 2 cut(s) 409, 538
AccB7I CCANNNNNTGG 2 cut(s) 225, 500
AccII CGCG 1 cut(s) 57
AclWI GGATC 2 cut(s) 54, 511
AcsI RAATTY 2 cut(s) 589, 727
AcuI CTGAAG 1 cut(s) 33
AfaI GTAC 4 cut(s) 263, 411, 446, 795
AfiI CCNNNNNNNGG 4 cut(s) 225, 419, 500, 562
AgsI TTSAA 6 cut(s) 37, 356, 512, 694, 720, 732
AhdI GACNNNNNGTC 1 cut(s) 432
AhlI ACTAGT 2 cut(s) 95, 431
AjnI CCWGG 3 cut(s) 269, 518, 555
AluBI AGCT 2 cut(s) 70, 441
AluI AGCT 2 cut(s) 70, 441
Alw26I GTCTC 2 cut(s) 206, 546
AlwI GGATC 2 cut(s) 54, 511
AoxI GGCC 2 cut(s) 465, 491
ApoI RAATTY 2 cut(s) 589, 727
ArsI GACNNNNNNTTYG 2 cut(s) 367, 399
Asp718I GGTACC 1 cut(s) 409
AspLEI GCGC 1 cut(s) 59
AspS9I GGNCC 1 cut(s) 465
AsuHPI GGTGA 1 cut(s) 171
BaeI ACNNNNGTAYC 2 cut(s) 401, 434
BanI GGYRCC 2 cut(s) 409, 538
BarI GAAGNNNNNNTAC 2 cut(s) 801, 833
BbsI GAAGAC 2 cut(s) 21, 363
BccI CCATC 2 cut(s) 313, 638
BceAI ACGGC 1 cut(s) 526
BciT130I CCWGG 3 cut(s) 271, 520, 557
BciVI GTATCC 1 cut(s) 825
BcoDI GTCTC 2 cut(s) 206, 546
BcuI ACTAGT 2 cut(s) 95, 431
BfaI CTAG 4 cut(s) 96, 242, 432, 489
BfmI CTRYAG 1 cut(s) 663
BfuI GTATCC 1 cut(s) 825
Bme1390I CCNGG 3 cut(s) 271, 520, 557
BmeRI GACNNNNNGTC 1 cut(s) 432
BmgT120I GGNCC 1 cut(s) 465
BmiI GGNNCC 3 cut(s) 411, 466, 540
BmrFI CCNGG 3 cut(s) 271, 520, 557
BmsI GCATC 1 cut(s) 659
BpiI GAAGAC 2 cut(s) 21, 363
BsaAI YACGTR 1 cut(s) 265
BsaBI GATNNNNATC 1 cut(s) 51
BsaI GGTCTC 1 cut(s) 546
BsaJI CCNNGG 1 cut(s) 556
BsaWI WCCGGW 1 cut(s) 181
Bsc4I CCNNNNNNNGG 4 cut(s) 225, 419, 500, 562
Bse1I ACTGG 1 cut(s) 219
Bse8I GATNNNNATC 1 cut(s) 51
BseBI CCWGG 3 cut(s) 271, 520, 557
BseDI CCNNGG 1 cut(s) 556
BseGI GGATG 2 cut(s) 623, 674
BseJI GATNNNNATC 1 cut(s) 51
BseLI CCNNNNNNNGG 4 cut(s) 225, 419, 500, 562
BseMII CTCAG 1 cut(s) 113
BseNI ACTGG 1 cut(s) 219
BseRI GAGGAG 1 cut(s) 139
Bsh1236I CGCG 1 cut(s) 57
BshFI GGCC 2 cut(s) 467, 493
BshNI GGYRCC 2 cut(s) 409, 538
BsiSI CCGG 2 cut(s) 182, 743
BsiWI CGTACG 1 cut(s) 261
BslI CCNNNNNNNGG 4 cut(s) 225, 419, 500, 562
BsmAI GTCTC 2 cut(s) 206, 546
BsmI GAATGC 1 cut(s) 191
BsnI GGCC 2 cut(s) 467, 493
Bso31I GGTCTC 1 cut(s) 546
Bsp1407I TGTACA 1 cut(s) 444
Bsp143I GATC 2 cut(s) 46, 503
BspANI GGCC 2 cut(s) 467, 493
BspCNI CTCAG 1 cut(s) 114
BspFNI CGCG 1 cut(s) 57
BspLI GGNNCC 3 cut(s) 411, 466, 540
BspMAI CTGCAG 1 cut(s) 667
BspPI GGATC 2 cut(s) 54, 511
BspT107I GGYRCC 2 cut(s) 409, 538
BspTNI GGTCTC 1 cut(s) 546
BsrGI TGTACA 1 cut(s) 444
BsrI ACTGG 1 cut(s) 219
BssECI CCNNGG 1 cut(s) 556
BssMI GATC 2 cut(s) 46, 503
Bst2UI CCWGG 3 cut(s) 271, 520, 557
BstAUI TGTACA 1 cut(s) 444
BstBAI YACGTR 1 cut(s) 265
BstDEI CTNAG 2 cut(s) 122, 190
BstF5I GGATG 2 cut(s) 623, 674
BstFNI CGCG 1 cut(s) 57
BstHHI GCGC 1 cut(s) 59
BstKTI GATC 2 cut(s) 49, 506
BstMAI GTCTC 2 cut(s) 206, 546
BstMBI GATC 2 cut(s) 46, 503
BstMWI GCNNNNNNNGC 1 cut(s) 490
BstNI CCWGG 3 cut(s) 271, 520, 557
BstSCI CCNGG 3 cut(s) 269, 518, 555
BstSFI CTRYAG 1 cut(s) 663
BstSNI TACGTA 1 cut(s) 265
BstUI CGCG 1 cut(s) 57
BstV2I GAAGAC 2 cut(s) 21, 363
BsuI GTATCC 1 cut(s) 825
BsuRI GGCC 2 cut(s) 467, 493
BtgZI GCGATG 2 cut(s) 38, 332
BtsCI GGATG 2 cut(s) 623, 674
BtsIMutI CAGTG 1 cut(s) 226
CfoI GCGC 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 465
CsiI ACCWGGT 1 cut(s) 518
Csp6I GTAC 4 cut(s) 262, 410, 445, 794
CviAII CATG 5 cut(s) 85, 255, 448, 763, 828
CviQI GTAC 4 cut(s) 262, 410, 445, 794
DdeI CTNAG 2 cut(s) 122, 190
DpnI GATC 2 cut(s) 48, 505
DpnII GATC 2 cut(s) 46, 503
DriI GACNNNNNGTC 1 cut(s) 432
Eam1105I GACNNNNNGTC 1 cut(s) 432
Eco105I TACGTA 1 cut(s) 265
Eco31I GGTCTC 1 cut(s) 546
Eco57I CTGAAG 1 cut(s) 33
EcoO109I RGGNCCY 1 cut(s) 465
EcoRII CCWGG 3 cut(s) 269, 518, 555
FaeI CATG 5 cut(s) 88, 258, 451, 766, 831
FalI AAGNNNNNCTT 2 cut(s) 140, 172
FatI CATG 5 cut(s) 84, 254, 447, 762, 827
FauNDI CATATG 1 cut(s) 138
FokI GGATG 2 cut(s) 630, 681
FspBI CTAG 4 cut(s) 96, 242, 432, 489
GlaI GCGC 1 cut(s) 58
HaeIII GGCC 2 cut(s) 467, 493
HapII CCGG 2 cut(s) 182, 743
HhaI GCGC 1 cut(s) 59
Hin1II CATG 5 cut(s) 88, 258, 451, 766, 831
Hin6I GCGC 1 cut(s) 57
HinP1I GCGC 1 cut(s) 57
HindIII AAGCTT 1 cut(s) 439
HinfI GANTC 2 cut(s) 274, 455
HpaII CCGG 2 cut(s) 182, 743
HphI GGTGA 1 cut(s) 171
Hpy188I TCNGA 3 cut(s) 13, 574, 652
Hpy188III TCNNGA 1 cut(s) 117
Hpy99I CGWCG 1 cut(s) 166
HpyCH4IV ACGT 2 cut(s) 260, 264
HpyCH4V TGCA 5 cut(s) 237, 484, 665, 672, 684
HpyF10VI GCNNNNNNNGC 1 cut(s) 490
HpyF3I CTNAG 2 cut(s) 122, 190
HpySE526I ACGT 2 cut(s) 260, 264
Hsp92II CATG 5 cut(s) 88, 258, 451, 766, 831
HspAI GCGC 1 cut(s) 57
KpnI GGTACC 1 cut(s) 413
Kzo9I GATC 2 cut(s) 46, 503
LmnI GCTCC 2 cut(s) 745, 781
LweI GCATC 1 cut(s) 659
MabI ACCWGGT 1 cut(s) 518
MaeI CTAG 4 cut(s) 96, 242, 432, 489
MaeII ACGT 2 cut(s) 260, 264
MaeIII GTNAC 1 cut(s) 177
MalI GATC 2 cut(s) 48, 505
MboI GATC 2 cut(s) 46, 503
MboII GAAGA 6 cut(s) 26, 260, 368, 409, 621, 779
MfeI CAATTG 2 cut(s) 507, 679
MluCI AATT 8 cut(s) 28, 291, 498, 507, 589, 679, 720, 727
MlyI GAGTC 1 cut(s) 268
MnlI CCTC 4 cut(s) 117, 120, 529, 574
MseI TTAA 8 cut(s) 27, 81, 90, 102, 111, 290, 525, 759
MslI CAYNNNNRTG 1 cut(s) 184
MspI CCGG 2 cut(s) 182, 743
MspR9I CCNGG 3 cut(s) 271, 520, 557
MunI CAATTG 2 cut(s) 507, 679
Mva1269I GAATGC 1 cut(s) 191
MvaI CCWGG 3 cut(s) 271, 520, 557
MvnI CGCG 1 cut(s) 57
MwoI GCNNNNNNNGC 1 cut(s) 490
NdeI CATATG 1 cut(s) 138
NdeII GATC 2 cut(s) 46, 503
NlaIII CATG 5 cut(s) 88, 258, 451, 766, 831
NlaIV GGNNCC 3 cut(s) 411, 466, 540
NmuCI GTSAC 1 cut(s) 177
PctI GAATGC 1 cut(s) 191
PfeI GAWTC 1 cut(s) 455
Pfl23II CGTACG 1 cut(s) 261
PflMI CCANNNNNTGG 2 cut(s) 225, 500
PleI GAGTC 1 cut(s) 268
PpsI GAGTC 1 cut(s) 268
Ppu21I YACGTR 1 cut(s) 265
Psp6I CCWGG 3 cut(s) 269, 518, 555
PspGI CCWGG 3 cut(s) 269, 518, 555
PspLI CGTACG 1 cut(s) 261
PspN4I GGNNCC 3 cut(s) 411, 466, 540
PspPI GGNCC 1 cut(s) 465
PstI CTGCAG 1 cut(s) 667
RsaI GTAC 4 cut(s) 263, 411, 446, 795
RsaNI GTAC 4 cut(s) 262, 410, 445, 794
RseI CAYNNNNRTG 1 cut(s) 184
SaqAI TTAA 8 cut(s) 27, 81, 90, 102, 111, 290, 525, 759
Sau3AI GATC 2 cut(s) 46, 503
Sau96I GGNCC 1 cut(s) 465
SchI GAGTC 1 cut(s) 268
ScrFI CCNGG 3 cut(s) 271, 520, 557
SexAI ACCWGGT 1 cut(s) 518
SfaNI GCATC 1 cut(s) 659
SfcI CTRYAG 1 cut(s) 663
SmiMI CAYNNNNRTG 1 cut(s) 184
SnaBI TACGTA 1 cut(s) 265
SpeI ACTAGT 2 cut(s) 95, 431
Sse9I AATT 8 cut(s) 28, 291, 498, 507, 589, 679, 720, 727
SspI AATATT 1 cut(s) 802
SspMI CTAG 4 cut(s) 96, 242, 432, 489
StyD4I CCNGG 3 cut(s) 269, 518, 555
TaiI ACGT 2 cut(s) 263, 267
TaqI TCGA 2 cut(s) 164, 285
TasI AATT 8 cut(s) 28, 291, 498, 507, 589, 679, 720, 727
TatI WGTACW 1 cut(s) 444
TfiI GAWTC 1 cut(s) 455
Tru1I TTAA 8 cut(s) 27, 81, 90, 102, 111, 290, 525, 759
Tru9I TTAA 8 cut(s) 27, 81, 90, 102, 111, 290, 525, 759
TscAI CASTG 1 cut(s) 226
TseFI GTSAC 1 cut(s) 177
Tsp45I GTSAC 1 cut(s) 177
TspDTI ATGAA 3 cut(s) 621, 786, 816
TspRI CASTG 1 cut(s) 226
Van91I CCANNNNNTGG 2 cut(s) 225, 500
XapI RAATTY 2 cut(s) 589, 727
XspI CTAG 4 cut(s) 96, 242, 432, 489
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.