Rmu_sc0004274.1_g000001

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004274.1
OG0018522
Physical Location & Seq
Forward (+)
2350 .. 3537
1188 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004274.1_g000001.1.cds

Sequence Viewer

Length: 1011 bp
atgtatgggcagactactagtcaaagcttgtacatggtagaatcagcaggggccttgttggtggttctgcaatctaggccaagaattggatcaattgaaaccaccaggtttagggtatttgaggtgccgtttggtagagaccacgggtgggagtggtcagatttggaggtaaagaatttggagaatagaagtctattcttgggatgtgaaagttcttcattctctgttgatggctcagactactattctgcaggatacaaagccaattgcatatacttcaacactaaatggtttgaccatatgattatcaagtttgtcttatcatcgaaccctttttcgtcaccggaatgcttagttctggtaagttatgagactgccagtggttgggggttttgcagactaggagaagatacacggacgtacgtagcctggactccaatactcgatttaatttatcacaacgggcagttttatgcgatggactgtagtggcagaatcttggtttgtgatgttgaagacccagagcaaccaatgacaactattttgctatcaaagaagataccaatggtacctatgtatgggcagactactagtcaaagcttgtacatggtagaatcagcaggggccttgttggtggttctgcaatctaggccaagaattggatcaattgaaaccaccaggtttagggtatttgaggtgccgtttggtagagaccacgggtgggagtggtcagatttggaggtaaagaatttggagaatagaagtctattcttgggatgtgaaagttcttcattctctgttgatggctcagactactattctgcaggatacaaagccaattgcatatacttcaacactaaatggtgggagtggctttcacttccaaatacaaactttggtccggctgtttttatctttaacatggaagatgaaaaggtggagcaactttcagtacctaatattttagaagccccactacatatttcatggatacaaataatgcgactataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box

Protein Analysis

336

Amino Acids

38.43

Weight (kDa)

4.89

Isoelectric Point (pI)

48.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018522)

Species Orthologous Gene IDs
prunus_persica Prupe.6G285400_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0284411 RchiOBHm_Chr6g0284431
rosa_laevigata RLG00000012746 RLG00000024920
rosa_multiflora Rmu_sc0000614.1_g000003 Rmu_sc0004274.1_g000001
rosa_roxburghii Rroxscaffold_1G00014080 Rroxscaffold_6G00418520
rosa_rugosa Rorug03G0051900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 568
AccB1I GGYRCC 3 cut(s) 124, 568, 697
AccB7I CCANNNNNTGG 3 cut(s) 86, 384, 659
AclWI GGATC 2 cut(s) 97, 670
AcsI RAATTY 2 cut(s) 175, 748
AfaI GTAC 5 cut(s) 32, 422, 570, 605, 954
AfiI CCNNNNNNNGG 8 cut(s) 86, 111, 148, 384, 578, 659, 684, 721
AgsI TTSAA 5 cut(s) 98, 280, 515, 671, 853
AhdI GACNNNNNGTC 2 cut(s) 18, 591
AhlI ACTAGT 2 cut(s) 17, 590
AjnI CCWGG 3 cut(s) 104, 428, 677
AluBI AGCT 2 cut(s) 27, 600
AluI AGCT 2 cut(s) 27, 600
Alw26I GTCTC 3 cut(s) 132, 365, 705
AlwI GGATC 2 cut(s) 97, 670
AoxI GGCC 4 cut(s) 51, 77, 624, 650
ApoI RAATTY 2 cut(s) 175, 748
ArsI GACNNNNNNTTYG 2 cut(s) 526, 558
Asp718I GGTACC 1 cut(s) 568
AspS9I GGNCC 3 cut(s) 51, 624, 899
AsuHPI GGTGA 1 cut(s) 333
AvaII GGWCC 1 cut(s) 899
BaeI ACNNNNGTAYC 2 cut(s) 560, 593
BanI GGYRCC 3 cut(s) 124, 568, 697
BarI GAAGNNNNNNTAC 2 cut(s) 960, 992
BbsI GAAGAC 1 cut(s) 522
BccI CCATC 3 cut(s) 224, 472, 797
BceAI ACGGC 2 cut(s) 112, 685
BciT130I CCWGG 3 cut(s) 106, 430, 679
BciVI GTATCC 3 cut(s) 248, 821, 984
BcoDI GTCTC 3 cut(s) 132, 365, 705
BcuI ACTAGT 2 cut(s) 17, 590
BfaI CTAG 5 cut(s) 18, 75, 401, 591, 648
BfmI CTRYAG 3 cut(s) 249, 484, 822
BfuI GTATCC 3 cut(s) 248, 821, 984
Bme1390I CCNGG 3 cut(s) 106, 430, 679
Bme18I GGWCC 1 cut(s) 899
BmeRI GACNNNNNGTC 2 cut(s) 18, 591
BmgT120I GGNCC 3 cut(s) 51, 624, 899
BmiI GGNNCC 5 cut(s) 52, 126, 570, 625, 699
BmrFI CCNGG 3 cut(s) 106, 430, 679
BpiI GAAGAC 1 cut(s) 522
BsaAI YACGTR 1 cut(s) 424
BsaI GGTCTC 2 cut(s) 132, 705
BsaJI CCNNGG 2 cut(s) 142, 715
BsaWI WCCGGW 1 cut(s) 343
Bsc4I CCNNNNNNNGG 8 cut(s) 86, 111, 148, 384, 578, 659, 684, 721
Bse1I ACTGG 1 cut(s) 378
BseBI CCWGG 3 cut(s) 106, 430, 679
BseDI CCNNGG 2 cut(s) 142, 715
BseGI GGATG 2 cut(s) 209, 782
BseLI CCNNNNNNNGG 8 cut(s) 86, 111, 148, 384, 578, 659, 684, 721
BseMII CTCAG 2 cut(s) 249, 822
BseNI ACTGG 1 cut(s) 378
BshFI GGCC 4 cut(s) 53, 79, 626, 652
BshNI GGYRCC 3 cut(s) 124, 568, 697
BsiSI CCGG 2 cut(s) 344, 902
BsiWI CGTACG 1 cut(s) 420
BslI CCNNNNNNNGG 8 cut(s) 86, 111, 148, 384, 578, 659, 684, 721
BsmAI GTCTC 3 cut(s) 132, 365, 705
BsmI GAATGC 1 cut(s) 353
BsnI GGCC 4 cut(s) 53, 79, 626, 652
Bso31I GGTCTC 2 cut(s) 132, 705
Bsp1407I TGTACA 2 cut(s) 30, 603
Bsp143I GATC 2 cut(s) 89, 662
BspANI GGCC 4 cut(s) 53, 79, 626, 652
BspCNI CTCAG 2 cut(s) 248, 821
BspLI GGNNCC 5 cut(s) 52, 126, 570, 625, 699
BspMAI CTGCAG 2 cut(s) 253, 826
BspPI GGATC 2 cut(s) 97, 670
BspT107I GGYRCC 3 cut(s) 124, 568, 697
BspTNI GGTCTC 2 cut(s) 132, 705
BsrGI TGTACA 2 cut(s) 30, 603
BsrI ACTGG 1 cut(s) 378
BssECI CCNNGG 2 cut(s) 142, 715
BssMI GATC 2 cut(s) 89, 662
Bst2UI CCWGG 3 cut(s) 106, 430, 679
Bst4CI ACNGT 1 cut(s) 485
BstAUI TGTACA 2 cut(s) 30, 603
BstBAI YACGTR 1 cut(s) 424
BstDEI CTNAG 3 cut(s) 235, 352, 808
BstDSI CCRYGG 2 cut(s) 142, 715
BstF5I GGATG 2 cut(s) 209, 782
BstKTI GATC 2 cut(s) 92, 665
BstMAI GTCTC 3 cut(s) 132, 365, 705
BstMBI GATC 2 cut(s) 89, 662
BstMWI GCNNNNNNNGC 2 cut(s) 76, 649
BstNI CCWGG 3 cut(s) 106, 430, 679
BstSCI CCNGG 3 cut(s) 104, 428, 677
BstSFI CTRYAG 3 cut(s) 249, 484, 822
BstSNI TACGTA 1 cut(s) 424
BstV2I GAAGAC 1 cut(s) 522
BsuI GTATCC 3 cut(s) 248, 821, 984
BsuRI GGCC 4 cut(s) 53, 79, 626, 652
BtgI CCRYGG 2 cut(s) 142, 715
BtgZI GCGATG 1 cut(s) 491
BtsCI GGATG 2 cut(s) 209, 782
BtsIMutI CAGTG 1 cut(s) 385
Cfr13I GGNCC 3 cut(s) 51, 624, 899
CsiI ACCWGGT 2 cut(s) 104, 677
Csp6I GTAC 5 cut(s) 31, 421, 569, 604, 953
CviAII CATG 4 cut(s) 34, 607, 922, 987
CviQI GTAC 5 cut(s) 31, 421, 569, 604, 953
DdeI CTNAG 3 cut(s) 235, 352, 808
DpnI GATC 2 cut(s) 91, 664
DpnII GATC 2 cut(s) 89, 662
DriI GACNNNNNGTC 2 cut(s) 18, 591
Eam1105I GACNNNNNGTC 2 cut(s) 18, 591
Eco105I TACGTA 1 cut(s) 424
Eco31I GGTCTC 2 cut(s) 132, 705
Eco47I GGWCC 1 cut(s) 899
EcoO109I RGGNCCY 2 cut(s) 51, 624
EcoRII CCWGG 3 cut(s) 104, 428, 677
FaeI CATG 4 cut(s) 37, 610, 925, 990
FalI AAGNNNNNCTT 2 cut(s) 302, 334
FatI CATG 4 cut(s) 33, 606, 921, 986
FauNDI CATATG 1 cut(s) 300
FokI GGATG 2 cut(s) 216, 789
FspBI CTAG 5 cut(s) 18, 75, 401, 591, 648
HaeIII GGCC 4 cut(s) 53, 79, 626, 652
HapII CCGG 2 cut(s) 344, 902
Hin1II CATG 4 cut(s) 37, 610, 925, 990
HindIII AAGCTT 2 cut(s) 25, 598
HinfI GANTC 4 cut(s) 41, 433, 495, 614
HpaII CCGG 2 cut(s) 344, 902
HphI GGTGA 1 cut(s) 333
Hpy188I TCNGA 4 cut(s) 160, 238, 733, 811
HpyCH4III ACNGT 1 cut(s) 485
HpyCH4IV ACGT 2 cut(s) 419, 423
HpyCH4V TGCA 7 cut(s) 70, 251, 270, 396, 643, 824, 843
HpyF10VI GCNNNNNNNGC 2 cut(s) 76, 649
HpyF3I CTNAG 3 cut(s) 235, 352, 808
HpySE526I ACGT 2 cut(s) 419, 423
Hsp92II CATG 4 cut(s) 37, 610, 925, 990
KpnI GGTACC 1 cut(s) 572
Kzo9I GATC 2 cut(s) 89, 662
LmnI GCTCC 1 cut(s) 940
MabI ACCWGGT 2 cut(s) 104, 677
MaeI CTAG 5 cut(s) 18, 75, 401, 591, 648
MaeII ACGT 2 cut(s) 419, 423
MaeIII GTNAC 1 cut(s) 339
MalI GATC 2 cut(s) 91, 664
MboI GATC 2 cut(s) 89, 662
MboII GAAGA 6 cut(s) 207, 419, 527, 568, 780, 938
MfeI CAATTG 4 cut(s) 93, 265, 666, 838
MluCI AATT 9 cut(s) 84, 93, 175, 265, 450, 657, 666, 748, 838
MlyI GAGTC 1 cut(s) 427
MnlI CCTC 4 cut(s) 115, 160, 688, 733
MseI TTAA 2 cut(s) 449, 918
MslI CAYNNNNRTG 1 cut(s) 346
MspI CCGG 2 cut(s) 344, 902
MspR9I CCNGG 3 cut(s) 106, 430, 679
MunI CAATTG 4 cut(s) 93, 265, 666, 838
Mva1269I GAATGC 1 cut(s) 353
MvaI CCWGG 3 cut(s) 106, 430, 679
MwoI GCNNNNNNNGC 2 cut(s) 76, 649
NdeI CATATG 1 cut(s) 300
NdeII GATC 2 cut(s) 89, 662
NlaIII CATG 4 cut(s) 37, 610, 925, 990
NlaIV GGNNCC 5 cut(s) 52, 126, 570, 625, 699
NmuCI GTSAC 1 cut(s) 339
PctI GAATGC 1 cut(s) 353
PfeI GAWTC 3 cut(s) 41, 495, 614
Pfl23II CGTACG 1 cut(s) 420
PflMI CCANNNNNTGG 3 cut(s) 86, 384, 659
PleI GAGTC 1 cut(s) 427
PpsI GAGTC 1 cut(s) 427
Ppu21I YACGTR 1 cut(s) 424
Psp6I CCWGG 3 cut(s) 104, 428, 677
PspGI CCWGG 3 cut(s) 104, 428, 677
PspLI CGTACG 1 cut(s) 420
PspN4I GGNNCC 5 cut(s) 52, 126, 570, 625, 699
PspPI GGNCC 3 cut(s) 51, 624, 899
PstI CTGCAG 2 cut(s) 253, 826
RsaI GTAC 5 cut(s) 32, 422, 570, 605, 954
RsaNI GTAC 5 cut(s) 31, 421, 569, 604, 953
RseI CAYNNNNRTG 1 cut(s) 346
SaqAI TTAA 2 cut(s) 449, 918
Sau3AI GATC 2 cut(s) 89, 662
Sau96I GGNCC 3 cut(s) 51, 624, 899
SchI GAGTC 1 cut(s) 427
ScrFI CCNGG 3 cut(s) 106, 430, 679
SexAI ACCWGGT 2 cut(s) 104, 677
SfcI CTRYAG 3 cut(s) 249, 484, 822
SinI GGWCC 1 cut(s) 899
SmiMI CAYNNNNRTG 1 cut(s) 346
SnaBI TACGTA 1 cut(s) 424
SpeI ACTAGT 2 cut(s) 17, 590
Sse9I AATT 9 cut(s) 84, 93, 175, 265, 450, 657, 666, 748, 838
SspI AATATT 1 cut(s) 961
SspMI CTAG 5 cut(s) 18, 75, 401, 591, 648
StyD4I CCNGG 3 cut(s) 104, 428, 677
TaaI ACNGT 1 cut(s) 485
TaiI ACGT 2 cut(s) 422, 426
TaqI TCGA 2 cut(s) 326, 444
TasI AATT 9 cut(s) 84, 93, 175, 265, 450, 657, 666, 748, 838
TatI WGTACW 2 cut(s) 30, 603
TfiI GAWTC 3 cut(s) 41, 495, 614
Tru1I TTAA 2 cut(s) 449, 918
Tru9I TTAA 2 cut(s) 449, 918
TscAI CASTG 1 cut(s) 385
TseFI GTSAC 1 cut(s) 339
Tsp45I GTSAC 1 cut(s) 339
TspDTI ATGAA 4 cut(s) 207, 780, 945, 975
TspGWI ACGGA 1 cut(s) 430
TspRI CASTG 1 cut(s) 385
Van91I CCANNNNNTGG 3 cut(s) 86, 384, 659
VpaK11BI GGWCC 1 cut(s) 899
XapI RAATTY 2 cut(s) 175, 748
XspI CTAG 5 cut(s) 18, 75, 401, 591, 648
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.