Rmu_sc0000674.1_g000030

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000674.1
Physical Location & Seq
Forward (+)
157868 .. 158233
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000674.1_g000030.1.cds

Sequence Viewer

Length: 366 bp
atggctagagttggtctggtttgcctagttcttctggctgggatccttgtggtccaggcaatggctgaaaaatctgagctgaacccaactgaggctaagccccaaaatggggttttagcagcacattcagattcagattcaggttcagatcagagtagtgtttctgttgctgaagagccatctcatagtatggaggagtctcaagtggctgaaggcccatctatcagaaggttggggtcctcaaaacatcaccaagataagtctgttgctggtggaggtgttattattggtgggcttgtcactgccatttttgcagctgtcttttgctacatcagagtcaccagaaaaaggggaggtgtttattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

12.58

Weight (kDa)

6.4

Isoelectric Point (pI)

48.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015675)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 61
AclWI GGATC 2 cut(s) 37, 50
AcuI CTGAAG 2 cut(s) 192, 231
AfiI CCNNNNNNNGG 6 cut(s) 61, 91, 107, 108, 109, 348
AjnI CCWGG 1 cut(s) 54
AluBI AGCT 2 cut(s) 79, 317
AluI AGCT 2 cut(s) 79, 317
Alw26I GTCTC 1 cut(s) 204
AlwI GGATC 2 cut(s) 37, 50
AoxI GGCC 1 cut(s) 214
ApeKI GCWGC 2 cut(s) 119, 314
AspS9I GGNCC 3 cut(s) 52, 215, 237
AsuHPI GGTGA 2 cut(s) 242, 331
AvaII GGWCC 2 cut(s) 52, 237
BamHI GGATCC 1 cut(s) 42
BbvI GCAGC 2 cut(s) 131, 326
BccI CCATC 2 cut(s) 187, 226
BciT130I CCWGG 1 cut(s) 56
BcoDI GTCTC 1 cut(s) 204
BfaI CTAG 2 cut(s) 6, 26
BisI GCNGC 2 cut(s) 120, 315
BlpI GCTNAGC 1 cut(s) 96
BlsI GCNGC 2 cut(s) 121, 316
Bme1390I CCNGG 1 cut(s) 56
Bme18I GGWCC 2 cut(s) 52, 237
BmgT120I GGNCC 3 cut(s) 52, 215, 237
BmiI GGNNCC 2 cut(s) 44, 238
BmrFI CCNGG 1 cut(s) 56
Bpu1102I GCTNAGC 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 186
Bsc4I CCNNNNNNNGG 6 cut(s) 61, 91, 107, 108, 109, 348
Bse3DI GCAATG 1 cut(s) 66
BseBI CCWGG 1 cut(s) 56
BseLI CCNNNNNNNGG 6 cut(s) 61, 91, 107, 108, 109, 348
BseMI GCAATG 1 cut(s) 66
BseMII CTCAG 2 cut(s) 66, 81
BseRI GAGGAG 1 cut(s) 209
BseXI GCAGC 2 cut(s) 131, 326
BseYI CCCAGC 1 cut(s) 38
BshFI GGCC 1 cut(s) 216
BslI CCNNNNNNNGG 6 cut(s) 61, 91, 107, 108, 109, 348
BsmAI GTCTC 1 cut(s) 204
BsnI GGCC 1 cut(s) 216
Bsp143I GATC 2 cut(s) 42, 148
Bsp1720I GCTNAGC 1 cut(s) 96
BspANI GGCC 1 cut(s) 216
BspCNI CTCAG 2 cut(s) 67, 82
BspLI GGNNCC 2 cut(s) 44, 238
BspPI GGATC 2 cut(s) 37, 50
BspQI GCTCTTC 1 cut(s) 168
BsrDI GCAATG 1 cut(s) 66
BssMI GATC 2 cut(s) 42, 148
Bst2UI CCWGG 1 cut(s) 56
Bst6I CTCTTC 1 cut(s) 168
BstDEI CTNAG 3 cut(s) 75, 90, 96
BstKTI GATC 2 cut(s) 45, 151
BstMAI GTCTC 1 cut(s) 204
BstMBI GATC 2 cut(s) 42, 148
BstMWI GCNNNNNNNGC 1 cut(s) 311
BstNI CCWGG 1 cut(s) 56
BstSCI CCNGG 1 cut(s) 54
BstV1I GCAGC 2 cut(s) 131, 326
BstX2I RGATCY 1 cut(s) 42
BstYI RGATCY 1 cut(s) 42
BsuRI GGCC 1 cut(s) 216
BtsI GCAGTG 1 cut(s) 300
BtsIMutI CAGTG 1 cut(s) 300
Cfr13I GGNCC 3 cut(s) 52, 215, 237
DdeI CTNAG 3 cut(s) 75, 90, 96
DpnI GATC 2 cut(s) 44, 150
DpnII GATC 2 cut(s) 42, 148
Eam1104I CTCTTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 168
Eco47I GGWCC 2 cut(s) 52, 237
Eco57I CTGAAG 2 cut(s) 192, 231
EcoO109I RGGNCCY 1 cut(s) 237
EcoRII CCWGG 1 cut(s) 54
FaiI YATR 2 cut(s) 186, 191
Fnu4HI GCNGC 2 cut(s) 120, 315
Fsp4HI GCNGC 2 cut(s) 120, 315
FspBI CTAG 2 cut(s) 6, 26
GluI GCNGC 2 cut(s) 120, 315
GsaI CCCAGC 1 cut(s) 42
HaeIII GGCC 1 cut(s) 216
HinfI GANTC 4 cut(s) 131, 137, 197, 336
HphI GGTGA 2 cut(s) 242, 331
Hpy188I TCNGA 7 cut(s) 76, 130, 136, 148, 153, 227, 335
HpyAV CCTTC 2 cut(s) 206, 222
HpyCH4V TGCA 1 cut(s) 314
HpyF10VI GCNNNNNNNGC 1 cut(s) 311
HpyF3I CTNAG 3 cut(s) 75, 90, 96
Kzo9I GATC 2 cut(s) 42, 148
LguI GCTCTTC 1 cut(s) 168
LpnPI CCDG 8 cut(s) 2, 20, 24, 41, 68, 126, 255, 355
Lsp1109I GCAGC 2 cut(s) 131, 326
MaeI CTAG 2 cut(s) 6, 26
MaeIII GTNAC 2 cut(s) 298, 337
MalI GATC 2 cut(s) 44, 150
MboI GATC 2 cut(s) 42, 148
MboII GAAGA 2 cut(s) 23, 185
MflI RGATCY 1 cut(s) 42
MlyI GAGTC 2 cut(s) 206, 345
MnlI CCTC 5 cut(s) 85, 187, 250, 269, 347
MseI TTAA 1 cut(s) 364
MspA1I CMGCKG 1 cut(s) 317
MspR9I CCNGG 1 cut(s) 56
MvaI CCWGG 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 311
NdeII GATC 2 cut(s) 42, 148
NlaIV GGNNCC 2 cut(s) 44, 238
NmuCI GTSAC 2 cut(s) 298, 337
PciSI GCTCTTC 1 cut(s) 168
PfeI GAWTC 2 cut(s) 131, 137
PflMI CCANNNNNTGG 1 cut(s) 61
PkrI GCNGC 2 cut(s) 121, 316
PleI GAGTC 2 cut(s) 205, 344
PpsI GAGTC 2 cut(s) 205, 344
PpuMI RGGWCCY 1 cut(s) 237
Psp5II RGGWCCY 1 cut(s) 237
Psp6I CCWGG 1 cut(s) 54
PspFI CCCAGC 1 cut(s) 38
PspGI CCWGG 1 cut(s) 54
PspN4I GGNNCC 2 cut(s) 44, 238
PspPI GGNCC 3 cut(s) 52, 215, 237
PspPPI RGGWCCY 1 cut(s) 237
PsuI RGATCY 1 cut(s) 42
PvuII CAGCTG 1 cut(s) 317
SapI GCTCTTC 1 cut(s) 168
SaqAI TTAA 1 cut(s) 364
SatI GCNGC 2 cut(s) 120, 315
Sau3AI GATC 2 cut(s) 42, 148
Sau96I GGNCC 3 cut(s) 52, 215, 237
SchI GAGTC 2 cut(s) 206, 345
ScrFI CCNGG 1 cut(s) 56
SetI ASST 6 cut(s) 81, 145, 233, 280, 319, 358
SinI GGWCC 2 cut(s) 52, 237
SmlI CTYRAG 1 cut(s) 201
SmoI CTYRAG 1 cut(s) 201
SspMI CTAG 2 cut(s) 6, 26
StyD4I CCNGG 1 cut(s) 54
TfiI GAWTC 2 cut(s) 131, 137
Tru1I TTAA 1 cut(s) 364
Tru9I TTAA 1 cut(s) 364
TscAI CASTG 1 cut(s) 307
TseFI GTSAC 2 cut(s) 298, 337
TseI GCWGC 2 cut(s) 119, 314
Tsp45I GTSAC 2 cut(s) 298, 337
TspRI CASTG 1 cut(s) 307
Van91I CCANNNNNTGG 1 cut(s) 61
VpaK11BI GGWCC 2 cut(s) 52, 237
XspI CTAG 2 cut(s) 6, 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.