Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000841.1

Orthogroup ID

OG0012180

Physical Location & Seq

Genomic Coordinates Forward (+)

85207 .. 86688

Gene Structure 1482 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000841.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1482 bp

atgcctagcagagatgttcatggacggattgtgcattggacttgtttggttactaagtacgcgagaggcggttgggtcgatgaggctcgggtgttgtttgatattatgccggagagaaatgtggttacttataatgctatgttgtcggggtatgtgcagtcagggaggttgagtgagggttgtcagttttttgaggagatgccggagaggaatgtggtgtcgtggacttcgatgctgtgtgggttggctggtgaggggaggattgaggaggcgaggcggttgtttgaggaaatgccagagaggaatgttgtttcttggaatgcgatgattgctgggttggttaagaatggggacttggagggagcaagggaggtttttgaccggatgcggatgaagaatgttgtttcttgtaatgctatgattggtgggtatgtggagcattgtagcatggatgaggccagagctttgtttgatgggatgctggataggaatgtgattacttggactagtatgatatctggttattgtaggtctggcaatgtggatgaagggtatgctttgttttgcaaaatgcccgagaggaatgttgtttcttggacagccatgattggtggctttgcttggaatggattttataaagaagctctattgttattccttgaatggaatgggaactatgaaacaagaccaaatggagagacgttcatatcgcttgtatatgcttgtgctggtattgggttgcctcatcttggaaagcaactacatgctcagttgattgtcaacaattgggaccatgatgattatgatggcaggctatcaaagagcctcattcacatgtactcggcctatggtgtcatggattatgcagattttctgtttatgaagcattcaaatactcgtagtgttcagtcttgtaattcaatgattaatggttacttacagattgggcaactagaacaggctcagaatctctttgacagactaccaatccgagacaagatctcttggacgtctatgatcaccgggtattttaatgttgggaaagtatcaaaggcttgttatctgttccaaattatgccagatagggatgcaatttcatggacagcgatgatttcagggcacgtccaaaatgagctttttgcagaagccactgatatcttctttaaaatgcgttcagaaggtgtttcgcctctgaattcaacatattcagttcttcttggagttgctggtgcaatgtcatatcttgattctgggagacagttccatggccttctgataaaaacacattatgaacttgacttgtttattagtaactcactgatctctatgtatgccaaatgtggggagatagatgacgcttaccgtgcattctcaaaaatgagtttgcgggatttgatttcttggaattccatgatcatggggttttctgaccatgggcatgcaaatgaagctctgaagatcgggcatcctgtcagcatgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR

Protein Analysis

493

Amino Acids

55.79

Weight (kDa)

5.72

Isoelectric Point (pI)

35.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012180)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G32415
fragaria_vesca	FvH4_5g21130 FvH4_5g21130 FvH4_5g21130
malus_domestica	MD06G1040900.v1.1
prunus_persica	Prupe.5G047200_v2.0.a1
pyrus_communis	pycom06g03410
rosa_chinensis	RchiOBHm_Chr7g0208251
rosa_laevigata	RLG00000003235
rosa_multiflora	Rmu_sc0000841.1_g000023 Rmu_sc0000841.1_g000024 Rmu_sc0007869.1_g000019
rosa_roxburghii	Rroxscaffold_3G00250640
rosa_rugosa	Rorug07G0102500
rosa_samantha	Rh7AG236700 Rh7BG232300 Rh7CG252600 Rh7DG242700
rosa_wichuraiana	Rw7G020200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	132, 636
AatII	GACGTC	1 cut(s)	1013
AccII	CGCG	1 cut(s)	62
AciI	CCGC	4 cut(s)	69, 277, 388, 1387
AcsI	RAATTY	2 cut(s)	1195, 1405
AcuI	CTGAAG	1 cut(s)	1475
AcyI	GRCGYC	1 cut(s)	1010
AfaI	GTAC	2 cut(s)	59, 839
AfiI	CCNNNNNNNGG	2 cut(s)	749, 1341
AflIII	ACRYGT	1 cut(s)	834
AgsI	TTSAA	4 cut(s)	662, 891, 921, 1200
AhlI	ACTAGT	1 cut(s)	506
AjiI	CACGTC	1 cut(s)	1123
AjuI	GAANNNNNNNTTGG	2 cut(s)	338, 370
AluBI	AGCT	4 cut(s)	464, 644, 1135, 1451
AluI	AGCT	4 cut(s)	464, 644, 1135, 1451
Alw26I	GTCTC	3 cut(s)	692, 987, 1249
Ama87I	CYCGRG	2 cut(s)	87, 575
AoxI	GGCC	3 cut(s)	456, 843, 1267
ApoI	RAATTY	2 cut(s)	1195, 1405
AseI	ATTAAT	1 cut(s)	927
AspS9I	GGNCC	1 cut(s)	790
AsuC2I	CCSGG	1 cut(s)	1024
AsuHPI	GGTGA	2 cut(s)	263, 1012
AvaI	CYCGRG	2 cut(s)	87, 575
AvaII	GGWCC	1 cut(s)	790
BaeGI	GKGCMC	1 cut(s)	1122
BccI	CCATC	2 cut(s)	467, 800
BclI	TGATCA	2 cut(s)	1017, 1413
BcnI	CCSGG	1 cut(s)	1024
BcoDI	GTCTC	3 cut(s)	692, 987, 1249
BcuI	ACTAGT	1 cut(s)	506
BfaI	CTAG	3 cut(s)	6, 507, 953
BglII	AGATCT	1 cut(s)	999
Bme1390I	CCNGG	1 cut(s)	1024
Bme18I	GGWCC	1 cut(s)	790
BmeT110I	CYCGRG	2 cut(s)	87, 575
BmgBI	CACGTC	1 cut(s)	1123
BmgT120I	GGNCC	1 cut(s)	790
BmiI	GGNNCC	1 cut(s)	791
BmrFI	CCNGG	1 cut(s)	1024
BmsI	GCATC	6 cut(s)	189, 222, 375, 468, 1078, 1474
BpuMI	CCSGG	1 cut(s)	1024
BsaHI	GRCGYC	1 cut(s)	1010
BsaJI	CCNNGG	2 cut(s)	1264, 1432
BsaWI	WCCGGW	1 cut(s)	381
BsaXI	ACNNNNNCTCC	2 cut(s)	157, 187
Bsc4I	CCNNNNNNNGG	2 cut(s)	749, 1341
Bse3DI	GCAATG	2 cut(s)	544, 1239
BseDI	CCNNGG	2 cut(s)	1264, 1432
BseGI	GGATG	7 cut(s)	390, 396, 457, 483, 550, 1093, 1465
BseLI	CCNNNNNNNGG	2 cut(s)	749, 1341
BseMI	GCAATG	2 cut(s)	544, 1239
BseMII	CTCAG	2 cut(s)	782, 977
BseRI	GAGGAG	2 cut(s)	209, 281
BseSI	GKGCMC	1 cut(s)	1122
BseYI	CCCAGC	1 cut(s)	332
BsgI	GTGCAG	1 cut(s)	176
Bsh1236I	CGCG	1 cut(s)	62
BshFI	GGCC	3 cut(s)	458, 845, 1269
BsiHKCI	CYCGRG	2 cut(s)	87, 575
BsiSI	CCGG	4 cut(s)	110, 203, 382, 1023
BslFI	GGGAC	2 cut(s)	365, 803
BslI	CCNNNNNNNGG	2 cut(s)	749, 1341
BsmAI	GTCTC	3 cut(s)	692, 987, 1249
BsmBI	CGTCTC	1 cut(s)	692
BsmFI	GGGAC	2 cut(s)	365, 803
BsmI	GAATGC	3 cut(s)	325, 886, 1367
BsnI	GGCC	3 cut(s)	458, 845, 1269
BsoBI	CYCGRG	2 cut(s)	87, 575
Bsp1286I	GDGCHC	1 cut(s)	1122
Bsp143I	GATC	5 cut(s)	999, 1017, 1320, 1413, 1458
Bsp19I	CCATGG	2 cut(s)	1264, 1432
BspACI	CCGC	4 cut(s)	69, 277, 388, 1387
BspANI	GGCC	3 cut(s)	458, 845, 1269
BspCNI	CTCAG	2 cut(s)	781, 976
BspFNI	CGCG	1 cut(s)	62
BspLI	GGNNCC	1 cut(s)	791
BsrDI	GCAATG	2 cut(s)	544, 1239
BssECI	CCNNGG	2 cut(s)	1264, 1432
BssMI	GATC	5 cut(s)	999, 1017, 1320, 1413, 1458
BssNI	GRCGYC	1 cut(s)	1010
BssT1I	CCWWGG	2 cut(s)	1264, 1432
Bst4CI	ACNGT	2 cut(s)	1260, 1364
BstACI	GRCGYC	1 cut(s)	1010
BstC8I	GCNNGC	2 cut(s)	812, 1440
BstDEI	CTNAG	3 cut(s)	54, 768, 963
BstDSI	CCRYGG	2 cut(s)	1264, 1432
BstF5I	GGATG	7 cut(s)	390, 396, 457, 483, 550, 1093, 1465
BstFNI	CGCG	1 cut(s)	62
BstKTI	GATC	5 cut(s)	1002, 1020, 1323, 1416, 1461
BstMAI	GTCTC	3 cut(s)	692, 987, 1249
BstMBI	GATC	5 cut(s)	999, 1017, 1320, 1413, 1458
BstMWI	GCNNNNNNNGC	3 cut(s)	329, 1364, 1448
BstNSI	RCATGY	4 cut(s)	767, 838, 1442, 1480
BstSCI	CCNGG	1 cut(s)	1022
BstSLI	GKGCMC	1 cut(s)	1122
BstUI	CGCG	1 cut(s)	62
BstX2I	RGATCY	1 cut(s)	999
BstXI	CCANNNNNNTGG	1 cut(s)	1417
BstYI	RGATCY	1 cut(s)	999
BsuRI	GGCC	3 cut(s)	458, 845, 1269
BtgI	CCRYGG	2 cut(s)	1264, 1432
BtgZI	GCGATG	2 cut(s)	338, 1121
BtrI	CACGTC	1 cut(s)	1123
BtsCI	GGATG	7 cut(s)	390, 396, 457, 483, 550, 1093, 1465
BtsIMutI	CAGTG	2 cut(s)	1149, 1316
Cac8I	GCNNGC	2 cut(s)	812, 1440
Cfr13I	GGNCC	1 cut(s)	790
CseI	GACGC	1 cut(s)	1364
Csp6I	GTAC	2 cut(s)	58, 838
CviQI	GTAC	2 cut(s)	58, 838
DdeI	CTNAG	3 cut(s)	54, 768, 963
DpnI	GATC	5 cut(s)	1001, 1019, 1322, 1415, 1460
DpnII	GATC	5 cut(s)	999, 1017, 1320, 1413, 1458
DraI	TTTAAA	1 cut(s)	1165
Eco130I	CCWWGG	2 cut(s)	1264, 1432
Eco32I	GATATC	2 cut(s)	516, 1156
Eco47I	GGWCC	1 cut(s)	790
Eco57I	CTGAAG	1 cut(s)	1475
Eco88I	CYCGRG	2 cut(s)	87, 575
EcoRI	GAATTC	2 cut(s)	1195, 1405
EcoRV	GATATC	2 cut(s)	516, 1156
EcoT14I	CCWWGG	2 cut(s)	1264, 1432
ErhI	CCWWGG	2 cut(s)	1264, 1432
Esp3I	CGTCTC	1 cut(s)	692
FaqI	GGGAC	2 cut(s)	365, 803
FauI	CCCGC	1 cut(s)	1380
FbaI	TGATCA	2 cut(s)	1017, 1413
FokI	GGATG	7 cut(s)	397, 403, 464, 490, 557, 1100, 1452
FspBI	CTAG	3 cut(s)	6, 507, 953
GsaI	CCCAGC	1 cut(s)	336
HaeIII	GGCC	3 cut(s)	458, 845, 1269
HapII	CCGG	4 cut(s)	110, 203, 382, 1023
HgaI	GACGC	1 cut(s)	1364
Hin1I	GRCGYC	1 cut(s)	1010
HincII	GTYRAC	1 cut(s)	781
HindII	GTYRAC	1 cut(s)	781
HinfI	GANTC	2 cut(s)	967, 1247
HpaII	CCGG	4 cut(s)	110, 203, 382, 1023
HphI	GGTGA	2 cut(s)	263, 1012
Hpy166II	GTNNAC	2 cut(s)	225, 781
Hpy188I	TCNGA	7 cut(s)	966, 992, 1177, 1194, 1275, 1429, 1455
Hpy188III	TCNNGA	1 cut(s)	1244
Hpy8I	GTNNAC	2 cut(s)	225, 781
HpyAV	CCTTC	3 cut(s)	542, 1172, 1280
HpyCH4III	ACNGT	2 cut(s)	1260, 1364
HpyCH4IV	ACGT	3 cut(s)	701, 1010, 1122
HpyCH4V	TGCA	9 cut(s)	34, 157, 567, 866, 1091, 1142, 1232, 1367, 1442
HpyF10VI	GCNNNNNNNGC	3 cut(s)	329, 1364, 1448
HpyF3I	CTNAG	3 cut(s)	54, 768, 963
HpySE526I	ACGT	3 cut(s)	701, 1010, 1122
Hsp92I	GRCGYC	1 cut(s)	1010
Ksp22I	TGATCA	2 cut(s)	1017, 1413
Kzo9I	GATC	5 cut(s)	999, 1017, 1320, 1413, 1458
LmnI	GCTCC	2 cut(s)	362, 436
LweI	GCATC	6 cut(s)	189, 222, 375, 468, 1078, 1474
MaeI	CTAG	3 cut(s)	6, 507, 953
MaeII	ACGT	3 cut(s)	701, 1010, 1122
MaeIII	GTNAC	4 cut(s)	49, 124, 932, 1310
MalI	GATC	5 cut(s)	1001, 1019, 1322, 1415, 1460
MboI	GATC	5 cut(s)	999, 1017, 1320, 1413, 1458
MboII	GAAGA	4 cut(s)	406, 1150, 1205, 1468
MfeI	CAATTG	1 cut(s)	784
MflI	RGATCY	1 cut(s)	999
MhlI	GDGCHC	1 cut(s)	1122
MluCI	AATT	6 cut(s)	784, 916, 1071, 1092, 1195, 1405
MseI	TTAA	4 cut(s)	342, 927, 1032, 1164
MslI	CAYNNNNRTG	4 cut(s)	833, 1415, 1437, 1443
MspI	CCGG	4 cut(s)	110, 203, 382, 1023
MspR9I	CCNGG	1 cut(s)	1024
MunI	CAATTG	1 cut(s)	784
Mva1269I	GAATGC	3 cut(s)	325, 886, 1367
MvnI	CGCG	1 cut(s)	62
MwoI	GCNNNNNNNGC	3 cut(s)	329, 1364, 1448
NciI	CCSGG	1 cut(s)	1024
NcoI	CCATGG	2 cut(s)	1264, 1432
NdeII	GATC	5 cut(s)	999, 1017, 1320, 1413, 1458
NlaIV	GGNNCC	1 cut(s)	791
NmeAIII	GCCGAG	1 cut(s)	821
NspI	RCATGY	4 cut(s)	767, 838, 1442, 1480
PaeI	GCATGC	1 cut(s)	1442
PciI	ACATGT	1 cut(s)	834
PcsI	WCGNNNNNNNCGW	1 cut(s)	227
PctI	GAATGC	3 cut(s)	325, 886, 1367
PfeI	GAWTC	2 cut(s)	967, 1247
PscI	ACATGT	1 cut(s)	834
PshBI	ATTAAT	1 cut(s)	927
PsiI	TTATAA	2 cut(s)	132, 636
PspFI	CCCAGC	1 cut(s)	332
PspN4I	GGNNCC	1 cut(s)	791
PspPI	GGNCC	1 cut(s)	790
PsuI	RGATCY	1 cut(s)	999
RsaI	GTAC	2 cut(s)	59, 839
RsaNI	GTAC	2 cut(s)	58, 838
RseI	CAYNNNNRTG	4 cut(s)	833, 1415, 1437, 1443
SaqAI	TTAA	4 cut(s)	342, 927, 1032, 1164
Sau3AI	GATC	5 cut(s)	999, 1017, 1320, 1413, 1458
Sau96I	GGNCC	1 cut(s)	790
ScrFI	CCNGG	1 cut(s)	1024
SduI	GDGCHC	1 cut(s)	1122
SfaNI	GCATC	6 cut(s)	189, 222, 375, 468, 1078, 1474
SinI	GGWCC	1 cut(s)	790
SmiMI	CAYNNNNRTG	4 cut(s)	833, 1415, 1437, 1443
SpeI	ACTAGT	1 cut(s)	506
SphI	GCATGC	1 cut(s)	1442
Sse9I	AATT	6 cut(s)	784, 916, 1071, 1092, 1195, 1405
SsiI	CCGC	4 cut(s)	69, 277, 388, 1387
SspMI	CTAG	3 cut(s)	6, 507, 953
StyD4I	CCNGG	1 cut(s)	1022
StyI	CCWWGG	2 cut(s)	1264, 1432
TaaI	ACNGT	2 cut(s)	1260, 1364
TaiI	ACGT	3 cut(s)	704, 1013, 1125
TaqI	TCGA	2 cut(s)	78, 230
TasI	AATT	6 cut(s)	784, 916, 1071, 1092, 1195, 1405
TatI	WGTACW	1 cut(s)	837
TfiI	GAWTC	2 cut(s)	967, 1247
Tru1I	TTAA	4 cut(s)	342, 927, 1032, 1164
Tru9I	TTAA	4 cut(s)	342, 927, 1032, 1164
TscAI	CASTG	2 cut(s)	1156, 1323
TspDTI	ATGAA	9 cut(s)	8, 407, 561, 693, 694, 896, 1086, 1305, 1461
TspGWI	ACGGA	1 cut(s)	40
TspRI	CASTG	2 cut(s)	1156, 1323
VpaK11BI	GGWCC	1 cut(s)	790
VspI	ATTAAT	1 cut(s)	927
XapI	RAATTY	2 cut(s)	1195, 1405
XceI	RCATGY	4 cut(s)	767, 838, 1442, 1480
XspI	CTAG	3 cut(s)	6, 507, 953
ZraI	GACGTC	1 cut(s)	1011

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.