Rmu_sc0000888.1_g000015

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000888.1
OG0013063
Physical Location & Seq
Forward (+)
55726 .. 58182
2457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000888.1_g000015.1.cds

Sequence Viewer

Length: 828 bp
atgatcggaaaacgagggctttatggatcaagtgcggcggagggaggtgcggagaagggtggagaggagcttgcgggaggaggacatggtggcaagtttggtaattatgatcggaaaacgagggctttatggatcaagagaccctcaaattttcctctccaaattccaactcatgctaaagccataaactttaatcttcccagatttccaacatcaagaaccagagcaacccttgaaggaaatgaccaaagtgccacagccacccctctgcttgctcaggaaccactgctcagcagagaagttgaggagagtgtgaaagtgctcaagaatgctgcaaaaacaagaaaggttgcagcagaggagattctggcagctctatctgtgcttgagaatgcaaaactggacccttctgggtttcttgaaacgcttggtgggacagaaccaccagggagaacttggatgctcatttttacttctgggaagaaattgaagggtggtagatactttcctattactgctgttcagcggttcgatgctgctggaaagagaattgagaatggagtatatcttgggccaattggagccttaacatttgaaggaagactttcttggaacaagagaatactggcctttgtttttgagagcattaggataaaaattggaagtttgaaacctttggagatcagtctaggccaaaaggatgacagagagcctagcaccaaggatcctttctttatatggttttacattgatgaagaattagcagttgctcgaggaaaaagtggggggactgctttctggtgccgctgtcatcgtgtaatgtcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

275

Amino Acids

30.13

Weight (kDa)

9.74

Isoelectric Point (pI)

40.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013063)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G18060
fragaria_vesca FvH4_5g16950 FvH4_5g16950 FvH4_5g16950
malus_domestica MD06G1223100.v1.1
prunus_persica Prupe.5G228200_v2.0.a1
pyrus_communis pycom14g19360
rosa_chinensis RchiOBHm_Chr7g0179071
rosa_laevigata RLG00000005388
rosa_multiflora Rmu_sc0000888.1_g000015
rosa_roxburghii Rroxscaffold_3G00274420
rosa_rugosa Rorug06G0420600 Rorug06G0420700.1
rosa_samantha Rh7AG020100 Rh7BG019800 Rh7CG021100 Rh7DG020600
rosa_wichuraiana Rw7G001670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 801
AciI CCGC 6 cut(s) 35, 38, 50, 74, 526, 805
AclWI GGATC 4 cut(s) 34, 140, 719, 732
AcsI RAATTY 2 cut(s) 148, 162
AgsI TTSAA 5 cut(s) 236, 422, 490, 596, 670
AjnI CCWGG 1 cut(s) 445
AjuI GAANNNNNNNTTGG 4 cut(s) 592, 624, 713, 745
AluBI AGCT 2 cut(s) 70, 374
AluI AGCT 2 cut(s) 70, 374
Alw21I GWGCWC 1 cut(s) 324
Alw26I GTCTC 1 cut(s) 133
AlwI GGATC 4 cut(s) 34, 140, 719, 732
Ama87I CYCGRG 1 cut(s) 771
AoxI GGCC 3 cut(s) 572, 627, 691
ApeKI GCWGC 4 cut(s) 332, 353, 371, 536
ApoI RAATTY 2 cut(s) 148, 162
Asp700I GAANNNNTTC 1 cut(s) 604
AspS9I GGNCC 2 cut(s) 403, 572
AvaI CYCGRG 1 cut(s) 771
AvaII GGWCC 1 cut(s) 403
BamHI GGATCC 1 cut(s) 724
BanI GGYRCC 1 cut(s) 801
BbsI GAAGAC 1 cut(s) 607
Bbv12I GWGCWC 1 cut(s) 324
BbvI GCAGC 4 cut(s) 319, 365, 383, 523
BciT130I CCWGG 1 cut(s) 447
BcoDI GTCTC 1 cut(s) 133
BfaI CTAG 2 cut(s) 689, 714
BisI GCNGC 6 cut(s) 36, 333, 354, 372, 537, 805
BlpI GCTNAGC 1 cut(s) 290
BlsI GCNGC 6 cut(s) 37, 334, 355, 373, 538, 806
Bme1390I CCNGG 1 cut(s) 447
Bme18I GGWCC 1 cut(s) 403
BmeT110I CYCGRG 1 cut(s) 771
BmgT120I GGNCC 2 cut(s) 403, 572
BmiI GGNNCC 5 cut(s) 282, 405, 583, 726, 803
BmrFI CCNGG 1 cut(s) 447
BmsI GCATC 2 cut(s) 450, 523
BpiI GAAGAC 1 cut(s) 607
Bpu10I CCTNAGC 1 cut(s) 276
Bpu1102I GCTNAGC 1 cut(s) 290
BpuEI CTTGAG 2 cut(s) 308, 407
BsaI GGTCTC 1 cut(s) 133
BsaJI CCNNGG 2 cut(s) 446, 720
Bse1I ACTGG 2 cut(s) 405, 630
BseBI CCWGG 1 cut(s) 447
BseDI CCNNGG 2 cut(s) 446, 720
BseGI GGATG 2 cut(s) 465, 706
BseMII CTCAG 2 cut(s) 290, 304
BseNI ACTGG 2 cut(s) 405, 630
BseRI GAGGAG 4 cut(s) 80, 93, 320, 374
BseXI GCAGC 4 cut(s) 319, 365, 383, 523
BshFI GGCC 3 cut(s) 574, 629, 693
BshNI GGYRCC 1 cut(s) 801
BsiHKAI GWGCWC 1 cut(s) 324
BsiHKCI CYCGRG 1 cut(s) 771
BslFI GGGAC 2 cut(s) 448, 802
BsmAI GTCTC 1 cut(s) 133
BsmFI GGGAC 2 cut(s) 448, 802
BsmI GAATGC 2 cut(s) 334, 397
BsnI GGCC 3 cut(s) 574, 629, 693
Bso31I GGTCTC 1 cut(s) 133
BsoBI CYCGRG 1 cut(s) 771
Bsp1286I GDGCHC 1 cut(s) 324
Bsp143I GATC 6 cut(s) 3, 26, 109, 132, 681, 724
Bsp1720I GCTNAGC 1 cut(s) 290
BspACI CCGC 6 cut(s) 35, 38, 50, 74, 526, 805
BspANI GGCC 3 cut(s) 574, 629, 693
BspCNI CTCAG 2 cut(s) 289, 303
BspLI GGNNCC 5 cut(s) 282, 405, 583, 726, 803
BspPI GGATC 4 cut(s) 34, 140, 719, 732
BspT107I GGYRCC 1 cut(s) 801
BspTNI GGTCTC 1 cut(s) 133
BsrI ACTGG 2 cut(s) 405, 630
BssECI CCNNGG 2 cut(s) 446, 720
BssMI GATC 6 cut(s) 3, 26, 109, 132, 681, 724
BssT1I CCWWGG 1 cut(s) 720
Bst2UI CCWGG 1 cut(s) 447
BstC8I GCNNGC 2 cut(s) 72, 273
BstDEI CTNAG 2 cut(s) 276, 290
BstF5I GGATG 2 cut(s) 465, 706
BstKTI GATC 6 cut(s) 6, 29, 112, 135, 684, 727
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 6 cut(s) 3, 26, 109, 132, 681, 724
BstNI CCWGG 1 cut(s) 447
BstSCI CCNGG 1 cut(s) 445
BstV1I GCAGC 4 cut(s) 319, 365, 383, 523
BstV2I GAAGAC 1 cut(s) 607
BstX2I RGATCY 1 cut(s) 724
BstYI RGATCY 1 cut(s) 724
BsuRI GGCC 3 cut(s) 574, 629, 693
BtsCI GGATG 2 cut(s) 465, 706
BtsI GCAGTG 1 cut(s) 284
BtsIMutI CAGTG 1 cut(s) 284
Cac8I GCNNGC 2 cut(s) 72, 273
Cfr13I GGNCC 2 cut(s) 403, 572
CviAII CATG 2 cut(s) 86, 173
DdeI CTNAG 2 cut(s) 276, 290
DpnI GATC 6 cut(s) 5, 28, 111, 134, 683, 726
DpnII GATC 6 cut(s) 3, 26, 109, 132, 681, 724
EciI GGCGGA 1 cut(s) 53
Eco130I CCWWGG 1 cut(s) 720
Eco31I GGTCTC 1 cut(s) 133
Eco47I GGWCC 1 cut(s) 403
Eco88I CYCGRG 1 cut(s) 771
EcoRII CCWGG 1 cut(s) 445
EcoT14I CCWWGG 1 cut(s) 720
ErhI CCWWGG 1 cut(s) 720
FaeI CATG 2 cut(s) 89, 176
FaiI YATR 9 cut(s) 24, 87, 108, 130, 174, 185, 565, 737, 739
FalI AAGNNNNNCTT 4 cut(s) 588, 620, 592, 624
FaqI GGGAC 2 cut(s) 448, 802
FatI CATG 2 cut(s) 85, 172
FauI CCCGC 1 cut(s) 67
Fnu4HI GCNGC 6 cut(s) 36, 333, 354, 372, 537, 805
FokI GGATG 2 cut(s) 472, 713
Fsp4HI GCNGC 6 cut(s) 36, 333, 354, 372, 537, 805
FspBI CTAG 2 cut(s) 689, 714
GluI GCNGC 6 cut(s) 36, 333, 354, 372, 537, 805
HaeIII GGCC 3 cut(s) 574, 629, 693
Hin1II CATG 2 cut(s) 89, 176
HinfI GANTC 1 cut(s) 364
Hpy188I TCNGA 2 cut(s) 8, 114
Hpy188III TCNNGA 6 cut(s) 136, 216, 278, 325, 419, 825
HpyAV CCTTC 5 cut(s) 49, 230, 417, 484, 590
HpyCH4V TGCA 3 cut(s) 335, 353, 395
HpyF3I CTNAG 2 cut(s) 276, 290
Hsp92II CATG 2 cut(s) 89, 176
Kzo9I GATC 6 cut(s) 3, 26, 109, 132, 681, 724
LmnI GCTCC 2 cut(s) 67, 581
Lsp1109I GCAGC 4 cut(s) 319, 365, 383, 523
LweI GCATC 2 cut(s) 450, 523
MaeI CTAG 2 cut(s) 689, 714
MalI GATC 6 cut(s) 5, 28, 111, 134, 683, 726
MboI GATC 6 cut(s) 3, 26, 109, 132, 681, 724
MboII GAAGA 4 cut(s) 188, 493, 612, 767
MfeI CAATTG 1 cut(s) 576
MflI RGATCY 1 cut(s) 724
MhlI GDGCHC 1 cut(s) 324
MluCI AATT 8 cut(s) 103, 148, 162, 485, 549, 576, 657, 758
MmeI TCCRAC 2 cut(s) 191, 233
MroXI GAANNNNTTC 1 cut(s) 604
MseI TTAA 2 cut(s) 192, 587
MspA1I CMGCKG 2 cut(s) 526, 807
MspR9I CCNGG 1 cut(s) 447
MunI CAATTG 1 cut(s) 576
Mva1269I GAATGC 2 cut(s) 334, 397
MvaI CCWGG 1 cut(s) 447
NdeII GATC 6 cut(s) 3, 26, 109, 132, 681, 724
NlaIII CATG 2 cut(s) 89, 176
NlaIV GGNNCC 5 cut(s) 282, 405, 583, 726, 803
PaeR7I CTCGAG 1 cut(s) 771
PctI GAATGC 2 cut(s) 334, 397
PdmI GAANNNNTTC 1 cut(s) 604
PfeI GAWTC 1 cut(s) 364
PkrI GCNGC 6 cut(s) 37, 334, 355, 373, 538, 806
Psp6I CCWGG 1 cut(s) 445
PspGI CCWGG 1 cut(s) 445
PspN4I GGNNCC 5 cut(s) 282, 405, 583, 726, 803
PspPI GGNCC 2 cut(s) 403, 572
PspXI VCTCGAGB 1 cut(s) 771
PsuI RGATCY 1 cut(s) 724
SaqAI TTAA 2 cut(s) 192, 587
SatI GCNGC 6 cut(s) 36, 333, 354, 372, 537, 805
Sau3AI GATC 6 cut(s) 3, 26, 109, 132, 681, 724
Sau96I GGNCC 2 cut(s) 403, 572
ScrFI CCNGG 1 cut(s) 447
SduI GDGCHC 1 cut(s) 324
SetI ASST 5 cut(s) 49, 72, 351, 376, 676
SfaNI GCATC 2 cut(s) 450, 523
Sfr274I CTCGAG 1 cut(s) 771
SinI GGWCC 1 cut(s) 403
SlaI CTCGAG 1 cut(s) 771
SmlI CTYRAG 3 cut(s) 323, 386, 771
SmoI CTYRAG 3 cut(s) 323, 386, 771
Sse9I AATT 8 cut(s) 103, 148, 162, 485, 549, 576, 657, 758
SsiI CCGC 6 cut(s) 35, 38, 50, 74, 526, 805
SspMI CTAG 2 cut(s) 689, 714
StyD4I CCNGG 1 cut(s) 445
StyI CCWWGG 1 cut(s) 720
TaqI TCGA 2 cut(s) 531, 772
TasI AATT 8 cut(s) 103, 148, 162, 485, 549, 576, 657, 758
TauI GCSGC 2 cut(s) 38, 807
TfiI GAWTC 1 cut(s) 364
Tru1I TTAA 2 cut(s) 192, 587
Tru9I TTAA 2 cut(s) 192, 587
TscAI CASTG 1 cut(s) 291
TseI GCWGC 4 cut(s) 332, 353, 371, 536
TspDTI ATGAA 1 cut(s) 768
TspRI CASTG 1 cut(s) 291
VpaK11BI GGWCC 1 cut(s) 403
XapI RAATTY 2 cut(s) 148, 162
XcmI CCANNNNNNNNNTGG 1 cut(s) 453
XhoI CTCGAG 1 cut(s) 771
XmnI GAANNNNTTC 1 cut(s) 604
XspI CTAG 2 cut(s) 689, 714
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.